Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
(Plasmid
#97312)
-
PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. Lenti backbone.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 97312 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLenti virus
-
Vector typeMammalian Expression, Mouse Targeting, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameActb HMEJ donor
-
Alt nameActb HMEJ template
-
gRNA/shRNA sequenceagtccgcctagaagcacttg
-
SpeciesSynthetic
-
Insert Size (bp)2431
- Promoter U6, EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
INSERT2:EGFP driven by EF1a promoter; INSERT3:U6-driven sgRNAs targeting Actb
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA was a gift from Hui Yang (Addgene plasmid # 97312 ; http://n2t.net/addgene:97312 ; RRID:Addgene_97312) -
For your References section:
Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Yao X, Wang X, Hu X, Liu Z, Liu J, Zhou H, Shen X, Wei Y, Huang Z, Ying W, Wang Y, Nie YH, Zhang CC, Li S, Cheng L, Wang Q, Wu Y, Huang P, Sun Q, Shi L, Yang H. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76. 10.1038/cr.2017.76 PubMed 28524166