Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pYZ164
(Plasmid #98408)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 98408 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pYZ033
  • Backbone size w/o insert (bp) 11350
  • Total vector size (bp) 11370
  • Vector type
    CRISPR
  • Selectable markers
    Spura4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting Sp.his3
  • gRNA/shRNA sequence
    Sp.his3 atttattggatataatgaca
  • Species
    S. pombe (fission yeast)
  • Entrez Gene
    his3 (a.k.a. SPBC11B10.02c)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYZ164 was a gift from Jef Boeke (Addgene plasmid # 98408 ; http://n2t.net/addgene:98408 ; RRID:Addgene_98408)
  • For your References section:

    Construction of Designer Selectable Marker Deletions with CRISPR-Cas9 Toolbox in Schizosaccharomyces pombe and Optimized Design of Common Entry Vectors. Zhao Y, Boeke JD. G3 (Bethesda). 2018 Jan 10. pii: g3.117.300363. doi: 10.1534/g3.117.300363. 10.1534/g3.117.300363 PubMed 29321167