pRL_yEGFP_hc
(Plasmid
#98746)
-
PurposeReporter plasmid for the PhiReX system. Encodes the reporter gene yEGFP under the control of the CYC1 minimal promoter with upstream synTALE-DBS.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98746 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepL0A_2-3
- Backbone size w/o insert (bp) 4703
- Total vector size (bp) 5929
-
Modifications to backboneInsertion of new homology regions A2 and A3
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYeast-enhanced green fluorescent protein
-
Alt nameyEGFP
-
Insert Size (bp)717
- Promoter synthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATTAGGTCCTTTGTAGC
- 3′ sequencing primer GGGACCTAGACTTCAGGTTGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRL_yEGFP_hc was a gift from Bernd Müller-Röber (Addgene plasmid # 98746 ; http://n2t.net/addgene:98746 ; RRID:Addgene_98746) -
For your References section:
PhiReX: a programmable and red light-regulated protein expression switch for yeast. Hochrein L, Machens F, Messerschmidt K, Mueller-Roeber B. Nucleic Acids Res. 2017 Sep 6;45(15):9193-9205. doi: 10.1093/nar/gkx610. 10.1093/nar/gkx610 PubMed 28911120