Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCW57.1-Tet-UPF1WT (pRKB264)
(Plasmid #99146)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99146 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    Addgene plasmid #41393
  • Backbone size w/o insert (bp) 7600
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UPF1
  • Alt name
    UPF1, RNA helicase and ATPase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3400
  • Mutation
    First 127 codons are optimized to reduce GC content
  • Entrez Gene
    UPF1 (a.k.a. HUPF1, NORF1, RENT1, UTF, pNORF1, smg-2)
  • Promoter pTight
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GTCAGATCGCCTGGAGAATT
  • 3′ sequencing primer CTAGTGAGACGTGCGGCTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A UPF1 sequence-verified cDNA clone was ordered from Dharmacon (clone ID 5555509). The UPF1 cDNA was then amplified and cloned into the Dox-inducible lentiviral vector pCW57.1 (Addgene #41393) using the Gibson Assembly Cloning Kit (NEB). Due to high GC content within the first 500 bp of UPF1 cDNA, several attempts to introduce an N-terminal FLAG-tag via PCR primer overhangs failed. The FLAG-tag sequence was therefore introduced after the ATG start codon by replacing the first 381 bp of the UPF1 coding sequence with an in-frame, codon-optimized (lower GC content) gBlock DNA fragment containing the FLAG-tag (IDT).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1-Tet-UPF1WT (pRKB264) was a gift from Robert Bradley (Addgene plasmid # 99146 ; http://n2t.net/addgene:99146 ; RRID:Addgene_99146)
  • For your References section:

    The RNA Surveillance Factor UPF1 Represses Myogenesis via Its E3 Ubiquitin Ligase Activity. Feng Q, Jagannathan S, Bradley RK. Mol Cell. 2017 Jul 20;67(2):239-251.e6. doi: 10.1016/j.molcel.2017.05.034. Epub 2017 Jun 29. 10.1016/j.molcel.2017.05.034 PubMed 28669802