-
PurposeEncodes 47xCAG repeats with 12xMS2 tag, 2nd generation lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR-TRE3G
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 8700
- Total vector size (bp) 9723
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name47xCAG 12xMS2 hairpins
-
SpeciesSynthetic
-
Insert Size (bp)1000
- Promoter TRE3G
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-Tre3G-47xCAG-12xMS2 was a gift from Ron Vale (Addgene plasmid # 99148 ; http://n2t.net/addgene:99148 ; RRID:Addgene_99148) -
For your References section:
RNA phase transitions in repeat expansion disorders. Jain A, Vale RD. Nature. 2017 Jun 8;546(7657):243-247. doi: 10.1038/nature22386. Epub 2017 May 31. 10.1038/nature22386 PubMed 28562589