pLXIN2
(Plasmid
#99203)
-
Purpose(Empty Backbone) Bicistronic retroviral vector (optimized internal ribosome entry site)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99203 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLXSN
-
Backbone manufacturerMiller, A.D., GenBank Acc. No. M28248
- Backbone size (bp) 5874
-
Modifications to backboneInternal SV40 promoter driving Neomycin (Geneticin; G-418) selection of pLXSN was replaced with IRES (internal ribosome entry site/sequence) from EMCV (encephalomyocarditis virus; GenBank NC_001479) to generate this bicistronic retroviral vector. The IRES was kept unaltered, and the translation initiation of neomycin phosphotransferase occurs at the 11th ATG of the IRES, identical to that of the wild type virus. Most commercial plasmid and retroviral vectors harbor an IRES where the 11th ATG is missing. Translation initiation begins 19 bp downstream off a synthetic ATG codon. The original MCS of pLXSN, EcoRI-HpaI-XhoI-BamHI was maintained unaltered.
-
Vector typeMammalian Expression, Retroviral
- Promoter LTR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GTGCAATCCATCTTGTTCAATGGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original pLXSN vector was obtained from Dr. Dusty Miller at Fred Hutchinson Cancer Center in Seattle, WA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When transfected into amphotropic (PA317) or ecotropic (PE501) mammalian packaging cell lines, the plasmid pLXIN2 will generate live retrovirus. Thus, the procedures will require handling at BSL2 level, when the plasmid is used to generate recombinant retrovirus for transduction.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLXIN2 was a gift from Saroj Mathupala (Addgene plasmid # 99203 ; http://n2t.net/addgene:99203 ; RRID:Addgene_99203)