pLXRN
(Plasmid
#99206)
-
Purpose(Empty Backbone) Bicistronic retroviral vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLXSN
-
Backbone manufacturerDr. Dusty Miller, Fred Hutchinson Cancer Center, Seattle, WA
-
Modifications to backboneThe SV40 promoter driving Neomycin selection marker was replaced with an internal ribosome entry site/sequence (IRES) from encephalomyocarditis virus to generate the bicistronic retroviral vector
-
Vector typeMammalian Expression, Retroviral
- Promoter LTR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionscan be propagated in E. coli DH5alpha. However, above strains are recommended to minimize recombination events.
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GTAAAGCATGTGCACCGAGGCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNeomycin marker is already in the parental vector pLXSN
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When transfected into packaging cell lines PE501 (ecotropic) or PA317 (amphotropic) the vector will generate live retrovirus. Thus, under these conditions BSL2 level safety will be required.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLXRN was a gift from Peter Pedersen (Addgene plasmid # 99206 ; http://n2t.net/addgene:99206 ; RRID:Addgene_99206)