Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pINDUCER22-MKK6E-Flag
(Plasmid #99259)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99259 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pINDUCER/22
  • Backbone manufacturer
    Dr. Thomas Westbrook, Baylor College of Medicine
  • Backbone size w/o insert (bp) 10437
  • Total vector size (bp) 11487
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MKK6E
  • Alt name
    Dual specificity mitogen-activated protein kinase kinase 6 (active)
  • Alt name
    MKK6(glu)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1050
  • Mutation
    S207E T211E
  • GenBank ID
    U39656 NM_002758.3
  • Entrez Gene
    MAP2K6 (a.k.a. MAPKK6, MEK6, MKK6, PRKMK6, SAPKK-3, SAPKK3)
  • Promoter TRE2
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GTTTGTACAAAAAAGCAGGC
  • 3′ sequencing primer CCACTTTGTACAAGAAAGCTGGGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    MKK6E was from Addgene plasmid #13518. pINDUCER/22 vector was from Dr. Thomas Westbrook, Baylor College of Medicine: Meerbrey KL, Hu G, Kessler JD, Roarty K, Li MZ, Fang JE, et al. The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo. Proceedings of the National Academy of Sciences of the United States of America. 2011;108(9):3665–70. Epub 2011/02/11. pmid:21307310; PubMed Central PMCID: PMC3048138.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains an IRES-GFP insert

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINDUCER22-MKK6E-Flag was a gift from Alejandro Adam & Peter Vincent (Addgene plasmid # 99259 ; http://n2t.net/addgene:99259 ; RRID:Addgene_99259)
  • For your References section:

    Src Family Kinases Modulate the Loss of Endothelial Barrier Function in Response to TNF-alpha: Crosstalk with p38 Signaling. Adam AP, Lowery AM, Martino N, Alsaffar H, Vincent PA. PLoS One. 2016 Sep 7;11(9):e0161975. doi: 10.1371/journal.pone.0161975. eCollection 2016. 10.1371/journal.pone.0161975 PubMed 27603666