pINDUCER22-MKK6E-Flag
(Plasmid
#99259)
-
PurposeLentiviral vector encoding a doxycycline-inducible Flag-tagged constitutively active MKK6.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99259 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepINDUCER/22
-
Backbone manufacturerDr. Thomas Westbrook, Baylor College of Medicine
- Backbone size w/o insert (bp) 10437
- Total vector size (bp) 11487
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMKK6E
-
Alt nameDual specificity mitogen-activated protein kinase kinase 6 (active)
-
Alt nameMKK6(glu)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1050
-
MutationS207E T211E
-
GenBank IDU39656 NM_002758.3
-
Entrez GeneMAP2K6 (a.k.a. MAPKK6, MEK6, MKK6, PRKMK6, SAPKK-3, SAPKK3)
- Promoter TRE2
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTTTGTACAAAAAAGCAGGC
- 3′ sequencing primer CCACTTTGTACAAGAAAGCTGGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMKK6E was from Addgene plasmid #13518. pINDUCER/22 vector was from Dr. Thomas Westbrook, Baylor College of Medicine: Meerbrey KL, Hu G, Kessler JD, Roarty K, Li MZ, Fang JE, et al. The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo. Proceedings of the National Academy of Sciences of the United States of America. 2011;108(9):3665–70. Epub 2011/02/11. pmid:21307310; PubMed Central PMCID: PMC3048138.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains an IRES-GFP insert
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINDUCER22-MKK6E-Flag was a gift from Alejandro Adam & Peter Vincent (Addgene plasmid # 99259 ; http://n2t.net/addgene:99259 ; RRID:Addgene_99259) -
For your References section:
Src Family Kinases Modulate the Loss of Endothelial Barrier Function in Response to TNF-alpha: Crosstalk with p38 Signaling. Adam AP, Lowery AM, Martino N, Alsaffar H, Vincent PA. PLoS One. 2016 Sep 7;11(9):e0161975. doi: 10.1371/journal.pone.0161975. eCollection 2016. 10.1371/journal.pone.0161975 PubMed 27603666