Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV pCAG-FLEX-mRuby3-WPRE
(Plasmid #99279)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99279 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV pCAG-FLEX-tdTomato-WPRE (Addgene #51503)
  • Backbone manufacturer
    Hongkui Zeng/Allen Institute For Brain Science
  • Backbone size w/o insert (bp) 5723
  • Total vector size (bp) 6455
  • Modifications to backbone
    A fragment containing reverse-complemented mRuby3 was swapped into replace tdTomato. Total AAV packaging size (including ITRs and DNA in between) is 3858 bp.
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mRuby3
  • Alt name
    monomeric ruby3
  • Alt name
    mRuby3 red fluorescent protein
  • Species
    Synthetic
  • Insert Size (bp)
    733

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer gcaacgtgctggttattgtg
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mRuby3 was synthesized de novo based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144)
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV pCAG-FLEX-mRuby3-WPRE was a gift from Rylan Larsen (Addgene plasmid # 99279 ; http://n2t.net/addgene:99279 ; RRID:Addgene_99279)