pSuper-Retro-Puro-Drp1-shRNA
(Plasmid #99385)

• Purpose: Expresses shRNA against human Drp1 from puromycin resistance retroviral vector
• Depositing Lab: David Kashatus
• Publication: Kashatus et al Mol Cell. 2015 Feb 5;57(3):537-51. doi: 10.1016/j.molcel.2015.01.002.

Backbone

• Vector backbone: pSuper-Retro-Puro
• Backbone manufacturer: Oligoengine
• Backbone size w/o insert (bp): 6313
• Total vector size (bp): 6374
• Vector type: Retroviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Dynamin-1-like protein
• Alt name: Drp1
• gRNA/shRNA sequence: CAGGAGCCAGCTAGATATTAA
• Species: H. sapiens (human)
• GenBank ID: NM_012062
• Entrez Gene: DNM1L (a.k.a. DLP1, DRP1, DVLP, DYMPLE, EMPF, EMPF1, HDYNIV, OPA5)
• Promoter: H1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (destroyed during cloning)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GGAAGCCTTGGCTTTTG
• 3′ sequencing primer: CGAACGCTGACGTCATC

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The shRNA target sequence employed in this vector was first identified and used in: Friedman, etal. Science 2011, 334, 358–362. (www.ncbi.nlm.nih.gov/pubmed/21885730)