pLEM415-ldhL-mRFP1
(Plasmid #99842)

• Purpose: Expression of RFP in Lactobacillus
• Depositing Lab: Sujin Bao
• Publication: Bao et al PLoS One. 2013;8(3):e60007. doi: 10.1371/journal.pone.0060007. Epub 2013 Mar 27.

Backbone

• Vector backbone: pLEM415
• Backbone manufacturer: Michel Fons
• Backbone size w/o insert (bp): 6332
• Total vector size (bp): 7357
• Modifications to backbone: the ldhl promoter was inserted 5’ of the FLAG-mRFP1
• Vector type: Bacterial Expression
• Selectable markers: Erythromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: LB medium
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: monomeric red fluorescent protein
• Alt name: mRFP1
• Species: Discosoma coral
• Insert Size (bp): 1025
• GenBank ID: AF506025
• Promoter: ldhl
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ApaI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: GCAAGGCGATTAAGTTGGGTAAC
• 3′ sequencing primer: ACGGTAAAACCATCGACCAATATCT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr. Roger Y. Tsien, UC San Diego
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Campbell RE, Tour O, Palmer AE, Steinbach PA, Baird GS, et al. (2002) A monomeric red fluorescent protein. Proc Natl Acad Sci U S A 99: 7877-7882.