This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Wayne Parrott Lab Plasmids


The Wayne Parrott Lab has deposited plasmids at Addgene for distribution to the research community. Addgene is a nonprofit plasmid repository dedicated to improving life science research.

Learn more about research in the Wayne Parrott Lab.

Addgene Alerts

Receive email alerts when new plasmids from this lab become available.

Log in to subscribe to Addgene Alerts.

Title Authors Publication
Simple gene silencing using the trans-acting siRNA pathway. Jacobs TB, Lawler NJ, LaFayette PR, Vodkin LO, Parrott WA Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362.
Targeted genome modifications in soybean with CRISPR/Cas9. Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA. BMC Biotechnology. 2015;15:16
The rice miniature inverted repeat transposable element mPing is an effective insertional mutagen in soybean. Hancock CN, Zhang F, Floyd K, Richardson AO, Lafayette P, Tucker D, Wessler SR, Parrott WA Plant Physiol. 2011 Oct;157(2):552-62. doi: 10.1104/pp.111.181206. Epub 2011 Aug 15.
ID Plasmid Gene/Insert Vector Type Publication Hidden Extra Search Info  
47024pUC gRNA ShuttlegRNA Shuttle (Synthetic)Plant Expression, CRISPR ; Cas9Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16 Encodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants. pUC19 Add to Cart
47025p201N 1514gma-miR1514 recognition sequence (Other), nptII selectable marker (Other)RNAiSimple gene silencing using the trans-acting siRNA pathway. Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. Contains soybean miRNA miR1514 recognition sequence to produce siRNAs from 3' target sequences and induce RNA silencing pPZP Add to Cart
47100pPingPing cDNA (Other), mPing (Other), hygromycin resistance gene (Other)Yeast Expression ; plant expressionThe rice miniature inverted repeat transposable element mPing is an effective insertional mutagen in soybean. Plant Physiol. 2011 Oct;157(2):552-62. doi: 10.1104/pp.111.181206. Epub 2011 Aug 15. Expresses the Ping open reading frame 1 (ORF1) and transposase from rice to allow mPing movement. The vector contains ORF1, transposase, mPing element and hph for hygromycin selection. pUHN4 Add to Cart
47101pPong_v2mPing (Other), Pong Open Reading Frame 1 (ORF1) (Other), Pong Transposase (Other)plant expressionThe rice miniature inverted repeat transposable element mPing is an effective insertional mutagen in soybean. Plant Physiol. 2011 Oct;157(2):552-62. doi: 10.1104/pp.111.181206. Epub 2011 Aug 15. Expresses the Pong ORF1 and transposase from rice to allow mPing movement. Contains ORF1 and transposase driven by a native soybean promoter. Contains mPing and BAR for basta selection. pUQ218 Add to Cart
55768p201N 1509RNAiSimple gene silencing using the trans-acting siRNA pathway. Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. Contains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencing pPZP Add to Cart
55769p201N 3514RNAiSimple gene silencing using the trans-acting siRNA pathway. Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. Contains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencing pPZP Add to Cart
55770p201N 1510a.2RNAiSimple gene silencing using the trans-acting siRNA pathway. Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. Contains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencing pPZP Add to Cart
55771p201N 1510RNAiSimple gene silencing using the trans-acting siRNA pathway. Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. Contains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencing pPZP Add to Cart
55772p201N 5770RNAiSimple gene silencing using the trans-acting siRNA pathway. Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. Contains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencing pPZP Add to Cart
59175p201N Cas9Cas9 (Synthetic), nptII (Other)CRISPRTargeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16 Cas9 driven by double 35S, nptII for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP Add to Cart
59176p201H Cas9Cas9 (Synthetic), hph (Other)CRISPRTargeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16 Cas9 driven by double 35S, hygromycin resistance for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP Add to Cart
59177p201B Cas9Cas9 (Synthetic), BAR (Other)CRISPRTargeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16 Cas9 driven by double 35S, BAR for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP Add to Cart
59178p201G Cas9Cas9 (Synthetic), sGFP (Synthetic)CRISPRTargeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16 Cas9 driven by double 35S, GFP for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP Add to Cart