Simple gene silencing using the trans-acting siRNA pathway.
Jacobs TB, Lawler NJ, LaFayette PR, Vodkin LO, Parrott WA
Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. PubMed Article
Jacobs TB, Lawler NJ, LaFayette PR, Vodkin LO, Parrott WA
Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. PubMed Article
Plasmids from Article
ID | Plasmid | Purpose |
---|---|---|
47025 | p201N 1514 | Contains soybean miRNA miR1514 recognition sequence to produce siRNAs from 3' target sequences and induce RNA silencing |
55768 | p201N 1509 | Contains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencing |
55769 | p201N 3514 | Contains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencing |
55770 | p201N 1510a.2 | Contains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencing |
55771 | p201N 1510 | Contains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencing |
55772 | p201N 5770 | Contains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencing |