Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Simple gene silencing using the trans-acting siRNA pathway.
Jacobs TB, Lawler NJ, LaFayette PR, Vodkin LO, Parrott WA
Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. PubMed Article

Plasmids from Article

ID Plasmid Purpose
47025p201N 1514Contains soybean miRNA miR1514 recognition sequence to produce siRNAs from 3' target sequences and induce RNA silencing
55768p201N 1509Contains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencing
55769p201N 3514Contains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencing
55770p201N 1510a.2Contains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencing
55771p201N 1510Contains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencing
55772p201N 5770Contains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencing

Antibodies from Article