Physiological and pathophysiological control of synaptic GluN2B-NMDA receptors by the C-terminal domain of amyloid precursor protein.
Pousinha PA, Mouska X, Raymond EF, Gwizdek C, Dhib G, Poupon G, Zaragosi LE, Giudici C, Bethus I, Pacary E, Willem M, Marie H
Elife. 2017 Jul 6;6. doi: 10.7554/eLife.25659. PubMed Article
Pousinha PA, Mouska X, Raymond EF, Gwizdek C, Dhib G, Poupon G, Zaragosi LE, Giudici C, Bethus I, Pacary E, Willem M, Marie H
Elife. 2017 Jul 6;6. doi: 10.7554/eLife.25659. PubMed Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 107543 | pAAV-AICD-NLS-IRES-hrGFP | AAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFP |
| 107544 | pAAV-AICD-NES-IRES-hrGFP | AAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFP |
| 107546 | pAAV-APLP1ICD-IRES-hrGFP | AAV-mediated expression of last 50 amino acids of APLP1 protein (APLP1ICD) and IRES-mediated co-expression of hrGFP to recognize labelled cells |
| 107548 | pAAV-syn-AICD-IRES-hrGFP | high transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFP |
| 107549 | pAAV-syn-IRES-hrGFP | high transduction efficiency AAV-mediated synapsin promoter-dependent expression IRES-hrGFP |