Structure-Mediated RNA Decay by UPF1 and G3BP1.
Fischer JW, Busa VF, Shao Y, Leung AKL
Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi: 10.1016/j.molcel.2020.01.021. Epub 2020 Feb 3. PubMed Article
Fischer JW, Busa VF, Shao Y, Leung AKL
Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi: 10.1016/j.molcel.2020.01.021. Epub 2020 Feb 3. PubMed Article
Plasmids from Article
ID | Plasmid | Purpose |
---|---|---|
135994 | pci-EGFP-UPF1-WT | WT UPF1 inserted with GFP tagged on the N-terminus used to stably integrate into cells |
135995 | pci-EGFP-UPF1-R615A | R615A UPF1 inserted with GFP tagged on the N-terminus used to stably integrate into cells |
135996 | pci-EGFP-UPF1-DEAA | DEAA UPF1 inserted with GFP tagged on the N-terminus used to stably integrate into cells |
135997 | pEGFP-C1-G3BP1-WT | WT G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cells |
135998 | pEGFP-C1-G3BP1-S149A | S149A G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cells |
135999 | pEGFP-C1-G3BP1-DeltaRBP | G3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminus |
136000 | pcDNA5 FRT-TO-EGFP-UPF1-WT | DOX-inducible WT UPF1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System |
136001 | pcDNA5 FRT-TO-EGFP-UPF1-R615A | DOX-inducible R615A UPF1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System |
136002 | pcDNA5 FRT-TO-EGFP-UPF1-DEAA | DOX-inducible DEAA UPF1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System |
136003 | pcDNA5 FRT TO-EGFP-G3BP1-WT | DOX-inducible WT G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System |
136004 | pcDNA5 FRT TO-EGFP-G3BP1-S149A | DOX-inducible S149A G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System |
136005 | pcDNA5 FRT TO-EGFP-G3BP1-DeltaRBP | DOX-inducible G3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System |
136006 | pCI-neo-lambdaN-UPF1-WT | WT UPF1 inserted with lambdaN tagged on the N-terminus to use with the Tethering Assay (BoxB) |
136007 | pCI-neo-lambdaN-UPF1-DEAA | DEAA UPF1 inserted with lambdaN tagged on the N-terminus to use with the Tethering Assay (BoxB) |
136008 | pCI-neo-His-MS2BP-G3BP1-WT | WT G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2) |
136009 | pCI-neo-His-MS2BP-G3BP1-S149A | S149A G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2) |
136010 | psi-CHECK3 | psi-CHECK2 plasmid modified so both Renilla and Firefly luciferase contain introns |
136011 | psi-CHECK3-3xBoxB-MS2 | 3 repeats of BoxB and MS2 hairpins inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid for the Tethering assay |
136012 | psiCHECK3-EIF3B | EIF3B 3'UTR (NM_001037283.1) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136013 | psiCHECK3-SDHAF3 | SDHAF3 3'UTR (NM_020186.2) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136014 | psiCHECK3-TMED3 | TMED3 3'UTR (NM_007364.3) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136015 | psiCHECK3-ZC3H15 | ZC3H15 3'UTR (NM_018471.2) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136016 | psiCHECK3-EIF3B-Reverse-Complement | The Reverse Complement of EIF3B 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136018 | psiCHECK3-TMED3-Reverse-Complement | The Reverse Complement of TMED3 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136019 | psiCHECK3-ZC3H15-Reverse-Complement | The Reverse Complement of ZC3H15 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136020 | psiCHECK3-EIF3B-1-147 | EIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136021 | psiCHECK3-EIF3B-148-464 | EIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136022 | psiCHECK3-EIF3B-465-552 | EIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136023 | psiCHECK3-EIF3B-1-464 | EIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136024 | psiCHECK3-EIF3B-148-552 | EIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136025 | psiCHECK3-Unstructured | Artificial Unstructured 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136026 | psiCHECK3-EIF3B-Unstructured | EIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136027 | psiCHECK3-Unstructured-EIF3B | EIF3B 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136028 | psiCHECK3-EIF3B-465-552-Unstructured | EIF3B (465-552) 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136029 | psiCHECK3-Unstructured-EIF3B-465-552 | EIF3B (465-552) 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136030 | psiCHECK3-EIF3B-88nt-Delta-Hairpin | EIF3B (465-552) 3'UTR with the main hairpin deleted inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136031 | psiCHECK3-EIF3B-88nt-1st-Hairpin | EIF3B (465-552) 3'UTR with only the main hairpin inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136032 | psiCHECK3-EIF3B-88nt-Disrupted-Hairpin | EIF3B (465-552) 3'UTR with the main hairpin mutated inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136033 | psiCHECK3-EIF3B-88nt-Restored-Hairpin | EIF3B (465-552) 3'UTR with the main hairpin restored inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136034 | psiCHECK3-EIF3B-88nt-A:U-Hairpin | EIF3B (465-552) 3'UTR with the main hairpin mutated to A and U nucleotides only inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid |
136035 | PLKO.1-Scrambled | Scrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG) |
136036 | PLKO.1-UPF1-3'UTR | UPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC) |
136037 | PLKO.1-UPF1-CDS | UPF1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (AAGACACCTATTACACGAAGG) |
136038 | PLKO.1-G3BP1-3'UTR | G3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT) |
136039 | PLKO.1-G3BP1-CDS | G3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT) |
136040 | PLKO.1-UPF2-CDS | UPF2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCGTTATGTTTGGTGGAAGAA) |
136041 | PLKO.1-UPF2-3'UTR | UPF2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CGCGAGGGTTAATCTTCTCTT) |
136042 | PLKO.1-UPF3A-3'UTR | UPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC) |
136043 | PLKO.1-UPF3A-CDS | UPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA) |
136044 | PLKO.1-UPF3B-3'UTR | UPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA) |
136045 | PLKO.1-UPF3B-CDS | UPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT) |
136046 | PLKO.1-SMG6-CDS-1 | SMG6 shRNA (Targeting CDS #1) inserted into the PLKO.1 plasmid (AACTTGTAAGTAACCTGCAGC) |
136047 | PLKO.1-SMG6-CDS-2 | SMG6 shRNA (Targeting CDS #2) inserted into the PLKO.1 plasmid (AAGGAGTTCCAGGTGTTACTG) |
136048 | PLKO.1-STAU1-CDS | STAU1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGAGTAAAGCCTAGAATCAAA) |
136049 | PLKO.1-STAU1-3'UTR | STAU1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CCATCACCACTGCTTTCTCTT) |
136050 | PLKO.1-STAU2-CDS | STAU2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GATATGAACCAACCTTCAA) |
136051 | PLKO.1-STAU2-3'UTR | STAU2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCAGGTAGTTGTTAGTGTTT) |
136052 | PLKO.1-REG1-3'UTR | REG1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (ATTGTATCTCTGTAGTTTAAG) |
136053 | PLKO.1-REG1-CDS | REG1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (TATGGGATCAAGTGCCGATTC) |
136054 | PLKO.1-CAPRIN1-CDS | CAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT) |
136055 | PLKO.1-CAPRIN1-3'UTR | CAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT) |
136056 | PLKO.1-USP10-3'UTR | USP10 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTCTCTTTAGTGGCTCTTT) |
136057 | PLKO.1-USP10-CDS | USP10 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTATGTGGAAACTAAGTATT) |
136058 | pSpCas9(BB)-2A-GFP-G3BP1(1) | G3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC) |
136059 | pSpCas9(BB)-2A-GFP-G3BP1(2) | G3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC) |
136060 | pSpCas9(BB)-2A-GFP-G3BP2(1) | G3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG) |
136061 | pSpCas9(BB)-2A-GFP-G3BP2(2) | G3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA) |