Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Clta


Description clathrin, light polypeptide (Lca)
Also known as Lca
Species Mus musculus
Entrez ID 12757
MGC ID BC057660

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene, or a homologous gene.

ID Plasmid Gene/Insert PI
20921EYFP-ClathrinClathrin, light polypeptide (Lca) (Mus musculus) Zhuang
21741Clathrin-LCa-EYFPClathrin, light polypeptide (LCa) (Mus musculus) Zhuang
21742Clathrin-LCa-ECFPClathrin, light polypeptide (LCa) (Mus musculus) Zhuang
27680CLC-pmCherryC1Clathrin Light Chain (Mus musculus) Merrifield
38009ptdEos-CLCClathrin, light polypeptide (LCa) (Mus musculus), Eos FP, tandem dimer Zhuang
38010pCLC-mEos2Clathrin, light polypeptide (LCa) (Mus musculus) Zhuang
38011pSNAP-CLC-EYFPClathrin, light polypeptide (LCa) (Mus musculus) Zhuang
38012pSNAP-CLC-SNAPClathrin, light polypeptide (LCa) (Mus musculus) Zhuang
40271prLCA-CitrineClta (Rattus norvegicus) Offterdinger
59353GFP-FKBP-LCaClathrin Light Chain A (Homo sapiens) Royle
70217pEGFP-GFP11-Clathrin light chainGFP11-Clathrin light chain (Homo sapiens) Huang
83032pEGFP_sfCherry2(11)_Clathrin light chainsfCherry2(11)_Clathrin light chain (Homo sapiens) Huang
109585p3E-CltaClathrin light chain a (Danio rerio) Parton
112016CLTA-GFP HDRT Source (pTR 153)CLTA-GFP HDRT (Homo sapiens) Marson
112017CLTA-mCherry HDRT Source (pTR 177)CLTA-mCherry HDRT (Homo sapiens) Marson
131483pORANGE GFP-Clta KIgRNA and GFP donor (Rattus norvegicus) MacGillavry
170858His-GFP-ClathrinClathrin light polypeptide (Lca) (Mus musculus) Taraska
186128pTR-177 pUC19-CLTA-N-mCherryCLTA (Homo sapiens) Marson
193552EGFP-ShadowY-CLCClathrin light chain A (Mus musculus) Taraska
217345gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (Homo sapiens), crFOLH1-1 gRNA: gctccagacctggggtccagttt (Homo sapiens), crCD151-3 gRNA: cgggaggccgcacccaccgcctg (Homo sapiens), crHBG-3 gRNA: ttcttcatccctagccagccgcc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert