Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pSIREN-RetroQ-ZsGreen
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Mammalian Expression
- Promoter
- PU6
- Cloning Method
- Unknown
- Size
- 6600
- 5' Sequencing 1 Primer
- U6
- 5' Sequencing 1 Primer Sequence
- 5'd[ATGGACTATCATATGCTTACCGTA]3'
- Bacterial Resistance
- Ampicillin
- Notes
- For retroviral siRNA expression. Use Green Fluorescence to monitor expression.
- Catalog Number
- 632455
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Retroviral