Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CRISPR Plasmids: Cut

Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism which frequently causes insertions or deletions (indels) in the DNA. Indels often lead to frameshifts, creating loss of function alleles.

To introduce specific genomic changes, researchers use ssDNA or dsDNA repair templates with 1. homology to the DNA flanking the DSB and 2. a specific edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental systems, HDR occurs at a much lower efficiency than NHEJ.


Browse, sort, or search the tables below for CRISPR plasmids designed to introduce a DSB.
Plasmids are available for expression in mammalian systems, bacteria, Drosophila, plants, C. elegans, yeast, zebrafish, and Xenopus.


Plasmid Gene/Insert Promoter Selectable Marker PI Publication Hidden Extra Search Info
hCas9Cas9CMV Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses human codon optimized Cas9 nuclease for genome engineering pcDNA3.3-TOPO
pX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-purohumanized S. pyogenes Cas9Puromycin Zhang Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013 Jan 3. This plasmid separately encodes a human codon-optimized SpCas9, a tracrRNA and customizable crRNA. pUC ori vector
pX330-U6-Chimeric_BB-CBh-hSpCas9humanized S. pyogenes Cas9CBh Zhang Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013 Jan 3. A human codon-optimized SpCas9 and chimeric guide RNA expression plasmid. pUC ori vector
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)
  • pMJ920Cas9 (Synthetic)CMV Doudna RNA-programmed genome editing in human cells. elife. 2013;2:e00471. doi: 10.7554/eLife.00471. Epub 2013 Jan 29. MacroLab 6D
    JDS246mammalian codon-optimized streptococcus pyogenes Cas9 - 3X FlagCMV Joung Joung lab unpublished CRISPR plasmids (unpublished) Expresses mammalian codon optimized Cas9 nuclease with C-term 3X FLAG from CMV and T7 promoters unknown
    p3s-Cas9HCCas9CMV Kim Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2507. pCDNA3.1
    pCas9_GFPCas9-2A-GFP (Synthetic)CAG Musunuru Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs. Cell Stem Cell. 2013 Apr 4;12(4):393-4. doi: 10.1016/j.stem.2013.03.006. Co-expression of human codon-optimized Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells pCAG
    pST1374-NLS-flag-linker-Cas9Human codon optimized Cas9CMVBlasticidin Huang Generation of gene-modified mice via Cas9/RNA-mediated gene targeting. Cell Res. 2013 Apr 2. doi: 10.1038/cr.2013.46. pST1374 (Addgene #13426)
    pSimpleII-NLS-NmCas9-HA-NLS(s)NmCas9 (Other)EF1a Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12. This plasmid encode NmCas9 with two NLS and a HA tag pSimpleII
    pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s)NmCas9 (Other), U6pr-tracrRNA (Other)EF1a, U6 Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12. This plasmid contains expression cassette for NmCas9 with N and C NLS and an HA tag, a cassette for expression of tracrRNA, a cassette for cloning crRNA under the control of U6 promoter. pSimpleII
    pSimpleII-NmCas9-FLAGNmCas9 (Other) Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12. FLAG tagged NmCas9 with no NLS. pSimpleII
    pSpCas9 (PX165)hSpCas9 (Synthetic)Cbh Zhang Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. Human codon optimized Cas9 nuclease from Streptococcus pyogenes (Cbh-3X-FLAG-NLS-SpCas9-NLS) PX165
    pSpCas9(BB)-2A-GFP (PX458)hSpCas9 (Synthetic)Cbh Zhang Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. Cas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNA PX458
    pSpCas9(BB)-2A-Puro (PX459)hSpCas9-2A-Puro (Synthetic)CbhPuromycin Zhang Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. NOTE: A new version of this plasmid is now available. See Addgene plasmid 62988. PX459
    pCAG-T3-hCAS-pACodon optimized Cas9 (Synthetic)CAG promoter Fujii Efficient generation of large-scale genome-modified mice using gRNA and CAS9 endonuclease. Nucleic Acids Res. 2013 Aug 30. Expresses CAS9 nuclease in mammalian cells. Used to modify genome of mouse embroys pCAGGS
    M-SPcasCas9 (Other)CMVNeomycin (select with G418) Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian S. pyogenes Cas9 expression, human optimized pcDNA3.3 TOPO
    M-ST1casCas9 (Other)CMVNeomycin (select with G418) Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian S. thermophilus #1 Cas9 expression, human optimized pcDNA3.3 TOPO
    M-NMcasCas9 (Other)CMVNeomycin (select with G418) Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian N. meningitidis Cas9 expression, human optimized pcDNA3.3 hygro
    pCW-Cas9humanized S. pyogenes Cas9Tet ONPuromycin Sabatini Genetic screens in human cells using the CRISPR-Cas9 system. Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12. Doxycycline-inducible lentiviral expression of SpCas9 pCW57.1
    pCAG-hCas9hCas9CAGNeomycin (select with G418) Hatada Generation of an ICF syndrome model by efficient genome editing of human induced pluripotent stem cells using the CRISPR system. Int J Mol Sci. 2013 Sep 30;14(10):19774-81. doi: 10.3390/ijms141019774. Expresses hCas9 under the CAG promoter for CRISPR pEGFP-N1
    lentiCRISPR v2Cas9 (Synthetic), Puromycin resistanceEFS-NS, EFS-NSPuromycin Zhang Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. Replaces original lentiCRISPRv1 (Addgene Plasmid 49535) and produces ~10-fold higher titer virus. 3rd generation lentiviral backbone. Custom
    lentiCas9-BlastCas9 (Synthetic), Blasticidin resistanceEFS-NS, EFS-NSBlasticidin Zhang Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. Expresses human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance from EFS promoter. 3rd generation lentiviral backbone. pFUGW
    pLenti-OC-IRES-BSDOCT1 (Homo sapiens), Cas9 (Other)CMVBlasticidin Wei High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 2014 Apr 9. doi: 10.1038/nature13166. To create stable cell clones with high-level expression of Cas9 and OCT1 pLenti-CMV-BSD POU2F1 OCT1, OTF1, oct-1B
    pLV hUbC-Cas9-T2A-GFPhumanized Cas9 T2A GFP (Other)hUbC Gersbach Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 2014 Aug 13. pii: gku749. 3rd generation transfer vector. Co-expresses human optimized S. pyogenes Cas9 and GFP FUGW
    pSQT834Csy4-T2A-Cas9-NLS (Homo sapiens)CAG Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Csy4 and Cas9 nuclease expression plasmid pCAG-CFP
    pSQT817Cas9CAG Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. wildtype Cas9 expression plasmid pCAG-CFP
    pL-CRISPR.EFS.GFPSpCas9 (Other), Sp sgRNA scaffold, EFS (Homo sapiens), P2A-eGFP (Synthetic)EFS, hU6 Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. EFS Promoter driven pLKO.005
    pL-CRISPR.EFS.tRFPSpCas9 (Other), Sp sgRNA scaffold, EFS (Homo sapiens), P2A-tRFP (Synthetic) Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. EFS Promoter driven pLKO.005
    pLKO5d.EFS.SpCas9.P2A.BSDSpCas9 (Other), EFS (Homo sapiens), P2A-BSD (Synthetic)Blasticidin Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter driven pLKO.005
    pL-CRISPR.SFFV.tRFPSpCas9 (Other), Sp sgRNA scaffold, SFFV (Synthetic), P2A-tRFP (Synthetic) Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter driven pLKO.005
    pL-CRISPR.SFFV.GFPSpCas9 (Other), Sp sgRNA scaffold, SFFV (Synthetic), P2A-eGFP (Synthetic) Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter driven pLKO.005
    pL-CRISPR.EFS.PACSpCas9 (Other), Sp sgRNA scaffold, EFS (Homo sapiens), P2A-PAC (Synthetic)Puromycin Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, EFS Promoter driven pLKO.005
    pL-CRISPR.SFFV.PACSpCas9 (Other), Sp sgRNA scaffold, SFFV (Synthetic), P2A-PAC (Synthetic)Puromycin Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, SFFV Promoter driven pLKO.005
    pAdSh.PGK.Cas9Human codon-optimized S. pyogenes Cas9 (Synthetic)Neomycin (select with G418) Goncalves Adenoviral vector delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi: 10.1038/srep05105. Expresses human codon-optimized S. pyogenes Cas9 from the human PGK-1 gene promoter pBR322-based pAdEasy backbone
    pLKO5d.EFS.SpCas9.P2A.PACSpCas9 (Other), EFS (Homo sapiens), P2A-PAC (Synthetic)Puromycin Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter driven pLKO.005
    Puro-Cas9 donorhSpCas9 (Other)Puromycin Huangfu An iCRISPR Platform for Rapid, Multiplexable, and Inducible Genome Editing in Human Pluripotent Stem Cells. Cell Stem Cell. 2014 Jun 11. pii: S1934-5909(14)00205-7. doi: 10.1016/j.stem.2014.05.018. Donor vector for genomic targeting of a Tetracycline-inducible Cas9 cassette to the human AAVS1/PPP1R12C locus N/A
    pX330A-1x2humanized S. pyogenes Cas9 nuclease (Other)CBh Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector
    piCRg EntryhSpCas9 Huangfu An iCRISPR Platform for Rapid, Multiplexable, and Inducible Genome Editing in Human Pluripotent Stem Cells. Cell Stem Cell. 2014 Jun 11. pii: S1934-5909(14)00205-7. doi: 10.1016/j.stem.2014.05.018. Cas9/gRNA Entry expression plasmid Low copy
    pCAG-T3-hCASeGFP-pACAS9 (Synthetic)CAG Fujii Efficient generation of large-scale genome-modified mice using gRNA and CAS9 endonuclease. Nucleic Acids Res. 2013 Aug 30. Expresses CAS9-eGFP fusion protein in mammalian cells. pCAGGS
    Eef1a-1955/-1>nls::Cas9::nlsnls::Cas9::nls (Other)Ciinte.Eef1a (EF1alpha) -1955/-1 Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. Eef1a (EF1alpha) promoter driving nls::Cas9::nls pCESAx
    Mesp-1916/-1>nls::Cas9::nlsnls::Cas9::nls (Other)Ciinte.Mesp -1916/-1 Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. Mesp driver driving nls::Cas9::nls pCESAx
    Sox1/2/3-2373/+3>nls::Cas9::nlsnls::Cas9::nls (Other)Ciinte.Sox1/2/3 (SoxB1) -2373/+3 Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. Sox1/2/3 (SoxB1) driver driving nls::Cas9::nls pCESAx
    pHL-EF1a-SphcCas9-iP-ACRISPR Cas9 (Other)Puromycin Hotta Precise Correction of the Dystrophin Gene in Duchenne Muscular Dystrophy Patient Induced Pluripotent Stem Cells by TALEN and CRISPR-Cas9. Stem Cell Reports. 2014 Nov 25. pii: S2213-6711(14)00335-X. doi: 10.1016/j.stemcr.2014.10.013. Expresses human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene. pHL-EF1a-GW-iP-A
    pSECCCas9 (Other), CreEFS, EFS (after Cas9-2A) Jacks Rapid modelling of cooperating genetic events in cancer through somatic genome editing. Nature. 2014 Oct 22. doi: 10.1038/nature13906. 3rd generation vector. Expresses a sgRNA of interest, Cas9 and Cre pLL3.3
    PX551SpCas9 (Synthetic)pMecp2 Zhang In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nat Biotechnol. 2014 Oct 19. doi: 10.1038/nbt.3055. pAAV-pMecp2-SpCas9-spA (AAV-SpCas9). AAV plasmid expressing Cas9 in neurons under control of truncated mecp2 promoter. pAAV
    LSL-Cas9-Rosa26TVCas9 (Synthetic), EGFPCAG, CAGNeomycin (select with G418) ; DTA Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Cre-dependent Cas9 expression plasmid and targeting vector for the mouse Rosa26 locus. Cas9 expression is Cre-dependent and the targeting vector has positive (Neo) and negative (DTA) selection. Ai9
    pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNAhSaCas9 (Other), Chimeric guide for SaCas9 (Other) Zhang In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015 Apr 1. doi: 10.1038/nature14299. A single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA. pAAV
    pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpAhSaCas9 (Other) Zhang In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015 Apr 1. doi: 10.1038/nature14299. A human codon-optimized Cas9 from Staphylococcus aureus (SaCas9). pAAV
    pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNAhSaCas9 (Other), Chimeric guide for SaCas9 (Other) Zhang In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015 Apr 1. doi: 10.1038/nature14299. A single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA. pAAV
    pMuLE ENTR CMV-hCas9 R4-R3human codon optimized Cas9 (Synthetic)CMV Frew A versatile modular vector system for rapid combinatorial mammalian genetics. J Clin Invest. 2015 Mar 9. pii: 79743. doi: 10.1172/JCI79743. MuLE (Multiple Lentiviral Expression) Entry vector containing CMV promoter and human codon optimized Cas9 module Compatible with MultiSite Gateway cloning N/A
    pMuLE ENTR SV40-hCas9 L3-L2human codon optimized Cas9 (Synthetic)SV40 Frew A versatile modular vector system for rapid combinatorial mammalian genetics. J Clin Invest. 2015 Mar 9. pii: 79743. doi: 10.1172/JCI79743. MuLE (Multiple Lentiviral Expression) Entry vector containing SV40 promoter and human codon optimized Cas9 module. Compatible with MultiSite Gateway cloning N/A
    pMuLE ENTR SV40-hCas9 L5-L2human codon optimized Cas9 (Synthetic)SV40 Frew A versatile modular vector system for rapid combinatorial mammalian genetics. J Clin Invest. 2015 Mar 9. pii: 79743. doi: 10.1172/JCI79743. MuLE (Multiple Lentiviral Expression) Entry vector containing SV40 promoter and human codon optimized Cas9 module. Compatible with MultiSite Gateway cloning N/A
    c3GIC9humanized S. Pyogenes Cas9 (Other)TRE3G Dow Inducible in vivo genome editing with CRISPR-Cas9. Nat Biotechnol. 2015 Apr;33(4):390-4. doi: 10.1038/nbt.3155. Epub 2015 Feb 18. col1a1 targeting vector for inducible [TRE3G]-GFP-IRES-Cas9 expression. Contains NsiI cloning site for U6-sgRNA cassettes col1a1 Flp-in targeting construct
    ptreCas9-mKate2ps-T1gRNACas9–mKate2ps (Synthetic) Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. Inducible; gRNA seq is ATGAGAATCAAGGCGGTCGA pTag-CFP
    pCas9–mKate2ps–EgRNACas9–mKate2ps (Synthetic) Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. Empty; no U6 gRNA cassette pTag-CFP
    pCas9–mKate2ps–T1gRNACas9–mKate2ps (Synthetic) Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. t1 gRNA (ATGAGAATCAAGGCGGTCGA) pTag-CFP
    PX851SpCas9 (aa 2-535)CBh Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. N-term SpCas9 piece of inducible split-4 (Cas9(N)-FRB-NES split-4). PX330
    PX852SpCas9 (aa536-1368)CBh Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. C-term SpCas9 piece of inducible split-4 (Cas9(C)-FKBP split-4). PX330
    PX853SpCas9 (aa 2-573)CBh Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. N-term SpCas9 piece of inducible split-5 (Cas9(N)-FRB-NES split-5). PX330
    PX854SpCas9 (aa573-1368)CBh Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. C-term SpCas9 piece of inducible split-5 (Cas9(C)-FKBP split-5). PX330
    pLSC-5SpCas9(574-1368), SpCas9(2-573)EFS, EFSPuromycin Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. Lenti vector for expression of inducible split Cas9 lentiCRISPR
    pSpCas9(BB)-2A-Puro (PX459) V2.0hSpCas9-2A-Puro V2.0 (Synthetic)CbhPuromycin Zhang Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. Cas9 from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0) PX459
    lentiCas9-EGFPCas9 (Synthetic), EGFP (Other)EFS-NS, EFS-NS Zhang Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis. Cell. 2015 Mar 12;160(6):1246-60. doi: 10.1016/j.cell.2015.02.038. Epub 2015 Mar 5. Expresses human codon-optimized S. pyogenes Cas9 protein and EGFP from EFS promoter. 3rd generation lentiviral backbone. pFUGW
    pX330S-2-PITChhumanized S. pyogenes Cas9 (Other)CBh Yamamoto MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc. 2016 Jan;11(1):118-33. doi: 10.1038/nprot.2015.140. Epub 2015 Dec 17. Expresses Cas9 nuclease and the PITCh-gRNA pUC ori vector
    pX330A-FBL/PITChhumanized S. pyogenes Cas9 (Other)CBh Yamamoto MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc. 2016 Jan;11(1):118-33. doi: 10.1038/nprot.2015.140. Epub 2015 Dec 17. Expresses Cas9 nuclease, FBL-specific gRNA, and the PITCh-gRNA pUC ori vector
    Adeno Cas9U6 and CBh Ventura In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014 Dec 18;516(7531):423-7. doi: 10.1038/nature13902. Epub 2014 Oct 22. Adenoviral vector for the expression of the Cas9 pacAd5
  • Tag / Fusion Protein
    • FLAG
  • pX333CBh; U6 Ventura In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014 Dec 18;516(7531):423-7. doi: 10.1038/nature13902. Epub 2014 Oct 22. Vector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter. pX333
  • Tag / Fusion Protein
    • 3XFLAG-Cas9 (N terminal on backbone)
  • pKMD106e - intein-Cas9(S219)mammalian codon-optimized S. pyogenes intein-Cas9(S219) - NLS - 3x FLAG (Other)CMV Liu Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol. 2015 May;11(5):316-8. doi: 10.1038/nchembio.1793. Epub 2015 Apr 6. Expresses intein-Cas9(S219) in mammalian cells pJDS246
    pKMD106h - intein-Cas9(C574)mammalian codon-optimized S. pyogenes intein-Cas9(C574) - NLS - 3x FLAG (Other)CMV Liu Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol. 2015 May;11(5):316-8. doi: 10.1038/nchembio.1793. Epub 2015 Apr 6. Expresses intein-Cas9(C574) in mammalian cells pJDS246
    pKMD111e - intein-Cas9(S219-G521R)mammalian codon-optimized S. pyogenes intein-Cas9(S219-G521R) - NLS - 3x FLAG (Other)CMV Liu Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol. 2015 May;11(5):316-8. doi: 10.1038/nchembio.1793. Epub 2015 Apr 6. Expresses intein-Cas9(S219-G521R) in mammalian cells pJDS246
    pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI)Cas9 (Other), hU6 promoter; BbsI sites for sgRNA, H1 promoter; BamHI site for shRNACBh, U6, H1 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry via T2A pU6-(BbsI)_CBh-Cas9-T2A-BFP
    pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1BCas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNA and for Expression of Cas9 linked to BFP via T2A linked to Ad4 E1B via P2A pU6-(BbsI)_CBh-Cas9-T2A-BFP
    pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1BCas9 (Other), sgRNA targeting ROSA26-1CBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2A pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
    pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6Cas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNA and Cas9 linked via T2A to BFP linked to the Ad4 E4orf6 gene via P2A pU6-(BbsI)_CBh-Cas9-T2A-BFP
    pU6-(BbsI)_CBh-Cas9-T2A-mcherry-P2A-Ad4E1BCas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNA and for Expression of Cas9 linked via T2A to mCherry and to Ad4 E1B55K via P2A pU6-(BbsI)_CBh-Cas9-T2A-mCherry
    pU6-(BbsI)_CBh-Cas9-T2A-mcherry-P2A-Ad4E4orf6Cas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNA and for Expression of Cas9 linked via T2A to mCherry linked to the Ad4 E4orf6 gene via P2A pU6-(BbsI)_CBh-Cas9-T2A-mCherry
    pU6-(BbsI)_CBh-Cas9-T2A-BFPCas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to BFP via a T2A peptide pX330
    pU6-(BbsI)_CBh-Cas9-T2A-mCherryCas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to mCherry via a T2A peptide pX330
    pMCS-rybozyme-IRES-CAS9CAS9 (Synthetic), HDV ribozyme (Other) Fujii Development of a mono-promoter-driven CRISPR/Cas9 system in mammalian cells. Sci Rep. 2015 Dec 16;5:18341. doi: 10.1038/srep18341. Plasmid encoding multiple cloning site, rybozyme and IRES-CAS9. pCAGGS
    pSaCas9_GFPSaCas9-2A-GFP (Synthetic)CAG Musunuru Staphylococcus aureus Cas9 (unpublished) Co-expression of human codon-optimized Staphylococcus aureus Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells and other mammalian cells pCAG
    pCas9–mKate2ps–CgRNACas9–mKate2ps Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. Control gRNA (GTCAAGGCACTCTTGCCTA) pTag-CFP
    MSCV_Cas9_puroCas9 (Synthetic)MSSV_LTRPuromycin Vakoc Discovery of cancer drug targets by CRISPR-Cas9 screening of protein domains. Nat Biotechnol. 2015 May 11. doi: 10.1038/nbt.3235. Retroviral introduction of Cas9 into mammalian cell line. MSCV_puro
    MSP469mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/R1335Q/T1337R)-NLS-3XFlag (Other)CMV & T7 Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for SpCas9 VQR variant: CMV-T7-humanSpCas9(D1135V/R1335Q/T1337R)-NLS-3xFLAG (VQR variant) JDS246
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • MSP680mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E/R1335Q/T1337R)-NLS-3XFlag (Other)CMV & T7 Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for SpCas9 EQR variant: CMV-T7-humanSpCas9(D1135E/R1335Q/T1337R)-NLS-3xFLAG (EQR variant) JDS246
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • MSP1101mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag (Other)CMV & T7 Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant) JDS246
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • MSP977mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E)-NLS-3XFlag (Other)CMV & T7 Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for SpCas9 D1135E variant: CMV-T7-humanSpCas9(D1135E)-NLS-3xFLAG JDS246
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • MSP1594mammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS (Other)CAG Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for S. thermophilus 1 Cas9: CAG-humanSt1Cas9-NLS pCAG-CFP
  • Tag / Fusion Protein
    • NLS (C terminal on insert)
  • BPK2139mammalian codon-optimized Staphylococcus aureus Cas9-NLS-3xFlag (Other)CAG Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for S .aureus Cas9: CAG-humanSaCas9-NLS-3xFLAG pCAG-CFP
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • pBGKCas9 Ohtsuka Mouse Genome Editing Using the CRISPR/Cas System. Curr Protoc Hum Genet. 2014 Oct 1;83:15.7.1-15.7.27. doi: 10.1002/0471142905.hg1507s83. Vector for Cas9 mRNA synthesis pcDNA3.1
    pCAS9-mCherry-Frame +0gRNA frame +0 Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint frame selector +0 pCAS9-mCherry
    pCAS9-mCherry-Frame +1gRNA frame +1 Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint frame selector +1 pCAS9-mCherry
    pCAS9-mCherry-Frame +2gRNA frame +2 Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint frame selector +2 pCAS9-mCherry
    pCAS9-mCherry-TUBBgRNA TUBB Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint target selector TUBB pCAS9-mCherry
    pCAS9-mCherry-ACTG1gRNA ACTG1 (Homo sapiens) Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint target selector ACTG1 pCAS9-mCherry
    pCAS9-mCherry-HIST1H4CgRNA HIST1H4C (Homo sapiens) Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint target selector HIST1H4C pCAS9-mCherry
    pKLV2-EF1a-BsdCas9-WEF1a-Cas9 cassette, WPRE (Homo sapiens)EF1a Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Lentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the N-terminus pKLV2 lentiviral vector
    pKLV2-U6gRNA5(Empty)-PGKGFP2ABFP-WU6gRNA cassette, PGKGFP2ABFP cassette, WPRE (Homo sapiens) Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Cas9 activity reporter (control) with GFP and BFP pKLV2 lentiviral vector
    pRosa26-EF1a-hCas9IRESneoEF1a-hCas9IRESneopA (Synthetic) Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Mouse Rosa26 targeting vector carrying the EF1a-hCas9-IRES-neo cassette pBluescriptII
    phumanCas9 (GB0575)Cas9 coding region (human codon optimised) (Other) Orzaez GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiol. 2013 Jul;162(3):1618-31. Provides the human codon optimized CDS of Cas9 protein as a level 0 GoldenBraid part pUPD
    PX377 Corynebacter diphtheriae Cas9CdCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Corynebacter diphtheriae Cas9 pDREAM
    PX378 Sutterella wadsworthensis Cas9SwCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Sutterella wadsworthensis Cas9 pDREAM
    PX379 Legionella pneumophila str. Paris Cas9LpCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Legionella pneumophila str. Paris Cas9 pDREAM
    PX380 Treponema denticola Cas9TdCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Treponema denticola Cas9 pDREAM
    PX381 Filifactor alocis Cas9FaCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Filifactor alocis Cas9 pDREAM
    PX382 Staphylococcus pseudintermedius Cas9SpsCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Staphylococcus pseudintermedius Cas9 pDREAM
    PX383 Lactobacillus johnsonii Cas9LjCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Lactobacillus johnsonii Cas9 pDREAM
    PX385 Streptococcus pasteurianus Cas9SpaCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Streptococcus pasteurianus Cas9 pDREAM
    PX386 Lactobacillus farciminis Cas9LfCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Lactobacillus farciminis Cas9 pDREAM
    PX387 Mycoplasma mobile Cas9MmCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Mycoplasma mobile Cas9 pDREAM
    PX388 Bacteroides coprophilus Cas9BcCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Bacteroides coprophilus Cas9 pDREAM
    PX389 Fluviicola taffensis Cas9FtCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Fluviicola taffensis Cas9 pDREAM
    PX390 Flavobacterium columnare Cas9FcCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Flavobacterium columnare Cas9 pDREAM
    PX391 Sphaerochaeta globus str. Buddy Cas9SgCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Sphaerochaeta globus str. Buddy Cas9 pDREAM
    PX392 Azospirillum B510 Cas9AzoCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Azospirillum B510 Cas9 pDREAM
    PX393 Gluconacetobacter diazotrophicus Cas9GdCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Gluconacetobacter diazotrophicus Cas9 pDREAM
    PX394 Neisseria cinerea Cas9NcCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Neisseria cinerea Cas9 pDREAM
    PX395 Roseburia intestinalis Cas9RiCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Roseburia intestinalis Cas9 pDREAM
    PX396 Parvibaculum lavamentivorans Cas9PlCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Parvibaculum lavamentivorans Cas9 pDREAM
    PX398 Nitratifractor salsuginis str DSM 16511 Cas9NsCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Nitratifractor salsuginis str DSM 16511 Cas9 pDREAM
    PX399 Mycoplasma gallisepticum str. F Cas9MgCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Mycoplasma gallisepticum str. F Cas9 pDREAM
    PX400 Campylobacter lari CF89-12 Cas9ClCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Campylobacter lari CF89-12 Cas9 pDREAM
    PX403 Streptococcus thermophilus LMD-9 CRISPR 3 Cas9St3Cas9 (Synthetic)CBh Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Streptococcus thermophilus LMD-9 CRISPR 3 Cas9 Unknown
    PX404 Campylobacter jejuni Cas9CjCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Campylobacter jejuni Cas9 Unknown
    pKLV2-EF1a-Cas9Bsd-WEF1a-Cas9 cassette, WPRE (Homo sapiens)EF1a Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Lentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the C-terminus pKLV2 lentiviral vector
    LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIRpuromycin (Synthetic), hCas9 (Synthetic)CAG, CAGPuromycin Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished) A Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expression Amp
    px330_SMAD exon 9 gRNASMAD exon 9 gRNA (Synthetic)U6 Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished) px330 with gRNA towards SMAD exon 9. Cas9 is expressed from a CAG promoter. amp
    CAS9PBKSCas9 (Other)CbAkt Bennett Genome editing using FACS enrichment of nuclease-expressing cells and indel detection by amplicon analysis. Nat Protoc. 2017 Mar;12(3):581-603. doi: 10.1038/nprot.2016.165. Epub 2017 Feb 16. CbAkt promoter driven Cas9-2A-GFP (from px458) pBKS
    Cas9-2A-CreCas9 and Cre recombinase (Homo sapiens)CAG Zhang Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. co-expressing Cas9 and Cre recombinase Cas9-2A-GFP
    PX405 Neisseria meningitidis Cas9NmCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Neisseria meningitidis Cas9 pDREAM
    PX406 Pasteurella multocida Cas9PmCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Pasteurella multocida Cas9 pDREAM
    PX408 Francisella tularensis subsp. novicida Cas9FtCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Francisella tularensis subsp. novicida Cas9 pDREAM
    pCSDest2-SpCas9-NLS-3XHA-NLS-Zif268Zif268 (Mus musculus) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses wild type SpCas9 fused to Zif268 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS Egr1 A530045N19Rik, ETR103, Egr-1, Krox-1, Krox-24, Krox24, NGF1-A, NGFI-A, NGFIA, TIS8, Zenk, Zfp-6, Zif268, egr
    pCSDest2-SpCas9-NLS-3XHA-NLSSpCas9 (Other) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses wild type SpCas9 in mammalian cells pCSDest2
    pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS2TS2 ZFP (Synthetic) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses wild type SpCas9 fused to ZFP-TS2 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS
    pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS3TS3 ZFP (Synthetic) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses wild type SpCas9 fused to ZFP-TS3 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS
    pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS4TS4 ZFP (Synthetic) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses wild type SpCas9 fused to ZFP-TS4 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS
    pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-ZFP_TS3TS3 ZFP (Synthetic) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses R1335K mutant SpCas9 fused to ZFP-TS3 in mammalian cell pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-Zif268
    pY004 (pcDNA3.1-hFnCpf1)hFnCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized FnCpf1 pcDNA3.1
    pY005 (pcDNA3.1-hLb3Cpf1)hLb3Cpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized Lb3Cpf1 pcDNA3.1
    pY006 (pcDNA3.1-hBpCpf1)hBpCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized BpCpf1 pcDNA3.1
    pY007 (pcDNA3.1-hPeCpf1)hPeCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized PeCpf1 pcDNA3.1
    pY008 (pcDNA3.1-hPbCpf1)hPbCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized LPbCpf1 pcDNA3.1
    pY009 (pcDNA3.1-hSsCpf1)hSsCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized SsCpf1 pcDNA3.1
    pY010 (pcDNA3.1-hAsCpf1)hAsCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized AsCpf1 pcDNA3.1
    pY011 (pcDNA3.1-hLb2Cpf1)hLb2Cpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized Lb2Cpf1 pcDNA3.1
    pY012 (pcDNA3.1-hCMtCpf1)hCMtCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized CMtCpf1 pcDNA3.1
    pY013 (pcDNA3.1-hEeCpf1)hEeCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized EeCpf1 pcDNA3.1
    pY014 (pcDNA3.1-hMbCpf1)hMbCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized MbCpf1 pcDNA3.1
    pY015 (pcDNA3.1-hLiCpf1)hLiCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized LiCpf1 pcDNA3.1
    pY016 (pcDNA3.1-hLbCpf1)hLbCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized LbCpf1 pcDNA3.1
    pY017 (pcDNA3.1-hPcCpf1)hPcCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized PcCpf1 pcDNA3.1
    pY018 (pcDNA3.1-hPdCpf1)hPdCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized PdCpf1 pcDNA3.1
    pY019 (pcDNA3.1-hPmCpf1)hPmCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized PmCpf1 pcDNA3.1
    FUCas9Cherryhumanised S.pyogenes cas9 (Other)hUbC Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26. Expresses Cas9 with fluorescent Cherry reporter FUGW
    lentiCas9-VenusCas9 (Synthetic), Venus Reporter (Synthetic)EFS-NS, P2AVenus Bauer BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature. 2015 Sep 16. doi: 10.1038/nature15521. Expresses human codon-optimized S. pyogenes Cas9 protein and Venus reporter from EFS promoter. Lentiviral backbone. pFUGW
    MSP1830mammalian codon-optimized KKH variant Staphylococcus aureus Cas9(E782K/N968K/R1015H)-NLS-3xFlag (Other)CAG Joung Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. 2015 Nov 2. doi: 10.1038/nbt.3404. Human expression plasmid for SaCas9 KKH variant: CAG-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG pCAG-CFP
    spCas9-BlastR (pCBhCas9-BlastR)spCas9CBhBlasticidin Sherwood Cloning-free CRISPR. Stem Cell Reports. 2015 Oct 27. pii: S2213-6711(15)00284-2. doi: 10.1016/j.stemcr.2015.09.022. Expresses SpCas9 and Blasticidin resistance p2Tol2
    pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)humanized S. pyogenes Cas9 fused to human Geminin (Homo sapiens)CBh Draetta Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair. Cell Rep. 2016 Feb 3. pii: S2211-1247(16)00040-1. doi: 10.1016/j.celrep.2016.01.019. A human codon-optimized SpCas9 fused to first 110 amino acids of human GEMININ and chimeric guide RNA expression plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 GMNN Gem, MGORS6
    eSpCas9(1.1)enhanced specificity Cas9 (1.1) (Other)CBh Zhang Rationally engineered Cas9 nucleases with improved specificity. Science. 2015 Dec 1. pii: aad5227. Expresses high specificity SpCas9. Px330-like plasmid. pX330-U6-Chimeric_BB-CBh-hSpCas9
    pCR1002T7pr_10xHis-MBP-TEV-SPyCas9 Corn Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 2016 Jan 20. doi: 10.1038/nbt.3481. Express Streptococcus pyogenes Cas9 SPynCas9
    VP12mammalian codon-optimized Streptococcus pyogenes Cas9 HF1(N497A/R661A/Q695A/Q926A)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-HF1 variant: CMV-T7-humanSpCas9-HF1(N497A, R661A, Q695A, Q926A)-NLS-3xFLAG JDS246
    MSP2135mammalian codon-optimized Streptococcus pyogenes Cas9 HF2(N497A/R661A/Q695A/Q926A/D1135E)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-HF2 variant: CMV-T7-humanSpCas9-HF2(N497A, R661A, Q695A, Q926A, D1135E)-NLS-3xFLAG JDS246
    MSP2133mammalian codon-optimized Streptococcus pyogenes Cas9 HF4(Y450A/N497A/R661A/Q695A/Q926A)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-HF4 variant: CMV-T7-humanSpCas9-HF4(Y450A, N497A, R661A, Q695A, Q926A)-NLS-3xFLAG JDS246
    MSP2440mammalian codon-optimized Streptococcus pyogenes Cas9 VQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/R1335Q/T1337R)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-VQR-HF1 variant: CMV-T7-humanSpCas9-VQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, R1335Q, T1337R)-NLS-3xFLAG JDS246
    BPK2797mammalian codon-optimized Streptococcus pyogenes Cas9 VRQR(D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-VRQR variant: CMV-T7-humanSpCas9-VRQR(D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAG JDS246
    MSP2443mammalian codon-optimized Streptococcus pyogenes Cas9 VRQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-VRQR-HF1 variant: CMV-T7-humanSpCas9-VRQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAG JDS246
    pCas9-polyACas9-polyadenine (Other)T7 Mashimo ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 2016 Jan 20;7:10431. doi: 10.1038/ncomms10431. express hCas9 byT7 promoter with polyadenine tails pcDNA3.3-TOPO
    MSP2372mammalian codon-optimized Streptococcus pyogenes Cas9 (R661A/Q695A/Q926A)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9(R661A/Q695A/Q926A) variant: CMV-T7-humanSpCas9(R661A, Q695A, Q926A)-NLS-3xFLAG JDS246
    Lenti‐Cas9‐2A‐BlastCas9 (Synthetic)EFS-NSBlasticidin Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25. Lentiviral vector expressing human codon-optimized S. pyogenes FLAG-tagged Cas9 and blasticidin resistance from EFS promoter lenti CRISPR pXPR_001
    pAAVS1-PDi-CRISPRnCas9 (Synthetic), rtTA (Synthetic)TRE, CAGPuromycin Conklin CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10. Dox-inducible CRISPR nuclease (CRISPRn) knock in construct into the AAVS1 locus pAAVS1
    pAWp30EFSp-Cas9-P2A-Zeo Lu Multiplexed barcoded CRISPR-Cas9 screening enabled by CombiGEM. Proc Natl Acad Sci U S A. 2016 Feb 10. pii: 201517883. pFUGW-EFSp-Cas9-P2A-Zeo pFUGW
    pTE4396As crRNA, AsCpf1human U6, CMVNeomycin (select with G418) Welker Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. Expresses human codon-optimized AsCpf1 and As crRNA. pcDNA3.1
    pTE4398Lb crRNA, LbCpf1human U6, CMVNeomycin (select with G418) Welker Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. Expresses human codon-optimized LbCpf1 and Lb crRNA. pcDNA3.1
    pBLO1811_Cas9_noNLS_humanCas9 (Homo sapiens) Savage Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528. Human codon optimized plasmid to express Cas9 t2a mCherry w/o NLS and a sgRNA px330
    pBLO1806_Cas9_2xNLS_humanCas9 (Homo sapiens) Savage Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528. Human codon optimized plasmid to express Cas9 t2a mCherry w/2xNLS and a sgRNA px330
    pLentiCRISPR-EGFP Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. Derived from LentiCRISPR v1 but expresses EGFP instead of puromycin resistance lentiCRISPRv1
  • Tag / Fusion Protein
    • EGFP
  • pLentiCRISPR-tagBFP Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. Derived from LentiCRISPR v1 but expresses tagBFP instead of puromycin resistance lentiCRISPRv1
  • Tag / Fusion Protein
    • tagBFP
  • pLentiCRISPR-mCherry Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. Derived from LentiCRISPR v1 but expresses mCherry instead of puromycin resistance. 3rd generation. lentiCRISPRv1
  • Tag / Fusion Protein
    • mCherry
  • pLentiCRISPR-RFP657 Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. Derived from LentiCRISPR v1 but expresses RFP657 instead of puromycin resistance lentiCRISPRv1
  • Tag / Fusion Protein
    • RFP657
  • FUG-T2A-Cas9Cas9Ubiquitin Luikart A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611. Ubiquitin promoter expresses GFP and humanized spCas9 (from PX330) via a T2A motif. For cell transfection or use in lentiviral packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL. FUGW
    pRubiC-T2A-Cas9Cas9Ubiquitin Luikart A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611. Ubiquitin promoter expresses mCherry and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL. pRubi
    pRubiG-T2A-Cas9Cas9Ubiquitin Luikart A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611. Ubiquitin promoter expresses GFP and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL. pRubi
    PXLCas9U6 Luikart A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611. PX330 derived. Bbs1 & annealed oligos to insert guide strand. BstB1+Pac1 of PXL and FUX-/pRubiX- T2A-Cas9 for choice of sgRNA, viral backbone, and fluorescent protein. Pac1 to introduce 2nd sgRNA. PX330
    pX330-BsaIx2-DD-Cas9DD-SpCas9 (Other)CAG Calos In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining. Nucleic Acids Res. 2016 Jan 13. pii: gkv1542. Expresses DD-SpCas9 in mammalian cells and has a cloning site for an sgRNA. The FKBP12 L106P destabilization domain allows for inducible stabilization of Cas9 through the addition of Shield-1 modified pX330
    pCas9-VRER_2A_GFPCas9-VRER (Synthetic)CAG Tessier-Lavigne Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9. Nature. 2016 May 5;533(7601):125-9. doi: 10.1038/nature17664. Epub 2016 Apr 27. Cas9 VRER variant that detects NGCG PAM, combined with 2A_GFP for expression control pCAG
    pXPR_BRD111Cas9Blasticidin Hahn Integrated genetic and pharmacologic interrogation of rare cancers. NATURE COMMUNICATIONS 7:11987 Expresses Cas9 with the pLX311 backbone pLX311
    CAG-Cas9-T2A-EGFP-ires-puroWT SpCas9-T2A-EGFP-ires-puromycin resistance (Other)CAGPuromycin Otonkoski An Activating STAT3 Mutation Causes Neonatal Diabetes through Premature Induction of Pancreatic Differentiation. Cell Rep. 2017 Apr 11;19(2):281-294. doi: 10.1016/j.celrep.2017.03.055. Expresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter. PyCAG
    pLentiCas9-T2A-BFPT2A-BFPIn frame with Cas9Blasticidin Guigo Scalable Design of Paired CRISPR Guide RNAs for Genomic Deletion. PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar. Cas9 protein with BFP Lenti-Cas9-blast
    pLentiCas9-T2A-GFPT2A-GFPIn frame with Cas9Blasticidin Guigo Scalable Design of Paired CRISPR Guide RNAs for Genomic Deletion. PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar. Cas9 protein with GFP Lenti-Cas9-blast
    pZac2.1 SV40-CMV-SaCas9-3xNLSSV40-CMV-SaCas9-3xNLS (Synthetic)SV40, CMV promoters Wagers In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31. AAV vector containing SaCas9 pZac2.1
    SQT1659mammalian codon-optimized Acidaminococcus sp. BV3L6 Cpf1-NLS-3xHA (Other)CAG Joung Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nat Biotechnol. 2016 Jun 27. doi: 10.1038/nbt.3620. Human expression plasmid for AsCpf1-NLS-3xHA pCAG-GFP
    SQT1665mammalian codon-optimized Lachnospiraceae bacterium ND2006 Cpf1-NLS-3xHA (Other)CAG Joung Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nat Biotechnol. 2016 Jun 27. doi: 10.1038/nbt.3620. Human expression plasmid for LbCpf1-NLS-3xHA pCAG-GFP
    pLentiCRISPR-EPuromycin Abbosh LentiCRISPR version E (unpublished) Introduce sgRNA into a lentiviral vector (LentiCRISPR V2) which contains eSpCas9 and puromycin cassette pLentiCRISPRV2
  • Tag / Fusion Protein
    • Cas9-P2A-Puro
  • pCAG-SpCas9-GFP-U6-gRNASpCas9CAG Zou pCAG-SpCas9-U6-gRNA (unpublished) All-in-one CRISPR/Cas9 vector with CAG promoter for expression in human ESC/iPSC pSpCas9(BB)-2A-GFP (PX458)
    pCAG-eCas9-GFP-U6-gRNAeSpCas9(1.1)CAG Zou pCAG-SpCas9-U6-gRNA (unpublished) All-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in human pluripotent stem cells eSpCas9(1.1)
    eSpCas9(1.1)_No_FLAGCBh Doyon A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells. Cell Rep. 2015 Oct 7. pii: S2211-1247(15)01020-7. doi: 10.1016/j.celrep.2015.09.009. FLAGless construct expressing high specificity eSpCas9(1.1). Px330-like plasmid. pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Tag / Fusion Protein
    • Untagged eSpCas9(1.1)
  • pTE4495Mb crRNA (Other), MbCpf1human U6, CMVNeomycin (select with G418) Welker Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. mammalian expression MbCpf1 nuclease and Mb crRNA pcDNA3.1
    pTE4497Fn crRNA (Other), FnCpf1human U6, CMVNeomycin (select with G418) Welker Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. mammalian expression FnCpf1 nuclease and Fn crRNA pcDNA3.1
    pDNR-SpCas9-GemSpCas9-Gem (Other)T7 Little A Cas9 Variant for Efficient Generation of Indel-Free Knockin or Gene-Corrected Human Pluripotent Stem Cells. Stem Cell Reports. 2016 Sep 13;7(3):508-17. doi: 10.1016/j.stemcr.2016.07.001. Epub 2016 Aug 4. Used for in vitro transcription of SpCas9-Gem mRNA. Cas9 is fused to Geminin peptide and is degraded during G0/G1 phases of the cell-cycle to minimize indels caused by non-homologous end joining pDNR-Dual
    pDNR-SpCas9SpCas9 (Other)T7 Little A Cas9 Variant for Efficient Generation of Indel-Free Knockin or Gene-Corrected Human Pluripotent Stem Cells. Stem Cell Reports. 2016 Sep 13;7(3):508-17. doi: 10.1016/j.stemcr.2016.07.001. Epub 2016 Aug 4. Used for in vitro transcription of SpCas9 mRNA. pDNR-Dual
    pDNR-SpCas9-Cdt1SpCas9-Cdt1 (Other) Little A Cas9 Variant for Efficient Generation of Indel-Free Knockin or Gene-Corrected Human Pluripotent Stem Cells. Stem Cell Reports. 2016 Sep 13;7(3):508-17. doi: 10.1016/j.stemcr.2016.07.001. Epub 2016 Aug 4. Used for in vitro transcription of SpCas9-Cdt1 mRNA. Cas9 is fused to Cdt1 peptide and is degraded during S/G2 phases of the cell-cycle. pDNR-Dual
    peSpCas9(1.1)-2×sgRNA (empty, donor) Nakayama Practical method for targeted disruption of cilia-related genes by using CRISPR/Cas9-mediated homology-independent knock-in system. Mol Biol Cell. 2017 Feb 8. pii: mbc.E17-01-0051. doi: 10.1091/mbc.E17-01-0051. All-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains eSpCas9(1.1) and two sgRNA expression cassettes. The first gRNA cloning site is empty. eSpCas9(1.1)
    pAAV-SMVP-Cas9NCas9N (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells. pZac2.1
    pAAV-SMVP-Cas9CCas9C (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9C in mammalian cells. pZac2.1
    pAAV-CASI-Cas9CCas9C (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9C in mammalian cells; derived from pZac2.1 with CASI promoter. pZac2.1
    pSMVP-Cas9NCas9N (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9N in mammalian cells. pMAX
    pSMVP-Cas9C-P2A-turboGFPCas9C (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9C in mammalian cells; co-expresses turboGFP. pMAX
    pSMVP-Cas9CCas9C (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9C in mammalian cells. pMAX
    pSMVP-Cas9FL-P2A-turboGFPCas9FL (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9FL in mammalian cells; co-expresses turboGFP. pMAX
    pAAV-CASI-Cas9C-P2A-turboGFPCas9C (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9C in mammalian cells; co-expresses turboGFP. pZac2.1
    pRZ-CAS9-mCherryCas9 (Synthetic)CMV Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. Cas9, mCherry expression pRZ
    pCAS9-mCherry empty Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. Cas9, mCherry, and sgRNA expression pCAS9
    pCAS9-BFP empty Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. Cas9, TagBFP, and sgRNA expression pCAS9
    Construct 7 - CMVp-Cas9-3xNLS-HSVpACas9-3xNLS (Homo sapiens) Lu Continuous genetic recording with self-targeting CRISPR-Cas in human cells. Science. 2016 Aug 18. pii: aag0511. Expresses Cas9 fused to 3xNLS driven by CMV promoter. For mammalian cell expression pGL2-Luc (Addgene #26280)
    Construct 12 - hUBCp_Cas9_3xNLS_p2a_puroRCas9-3xNLS (Homo sapiens)Puromycin Lu Continuous genetic recording with self-targeting CRISPR-Cas in human cells. Science. 2016 Aug 18. pii: aag0511. Lentiviral construct for building stable cell lines expressing Cas9 via puromycin selection Lentiviral
    Construct 33 - NFKBRp_Cas9_3xNLS_p2a-puroRCas9-3xNLSPuromycin Lu Continuous genetic recording with self-targeting CRISPR-Cas in human cells. Science. 2016 Aug 18. pii: aag0511. Lentiviral construct for building stable cell lines expressing Cas9 in the presence of TNFa via puromycin selection Lentiviral
    LentiCRISPRv2CreCre Recombinase (Other)EFS (P2A) Feldser Systematic in vivo inactivation of chromatin regulating enzymes identifies Setd2 as a potent tumor suppressor in lung adenocarcinoma. Cancer Res. 2017 Feb 15. pii: canres.2159.2016. doi: 10.1158/0008-5472.CAN-16-2159. Lentiviral vector expressing Cre recombinase alongside Cas9 and an sgRNA cloning site lentiCRISPR v2 (Addgene #52961)
    LentiCRISPRv2GFPGFP (Other)EFS (P2A) Feldser Systematic in vivo inactivation of chromatin regulating enzymes identifies Setd2 as a potent tumor suppressor in lung adenocarcinoma. Cancer Res. 2017 Feb 15. pii: canres.2159.2016. doi: 10.1158/0008-5472.CAN-16-2159. 3rd generation lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning site lentiCRISPR v2
    lentiCRISPR v2-BlastBlasticidin S deaminaseEF-1αBlasticidin Babu CRISPR/Cas9-based system for loss-of-function screening (unpublished) Mammalian expression of Cas9 and sgRNA scaffold lentiCRISPR v2 (#52961)
    pCW-Cas9-BlastSpCas9, Blasticidin S deaminase -T2A - reverse tetracycline-controlled transactivatorTight Tre, human phosphoglycerate kinase 1 promoterBlasticidin Babu CRISPR/Cas9-based system for loss-of-function screening (unpublished) Lentiviral vector for mammalian expression of doxycycline-inducible Cas9 and constitutive expression of Blasticidin S deaminaase -T2A -rtTA pCW-Cas9 (#50661)
    pLV-U6-gRNA-UbC-DsRed-P2A-BsrDsRed-Express2, BsrhUbCBlasticidin Gersbach CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853. Lentiviral SpCas9-gRNA expression vector with DsRed-Express2-P2A-BlastR FUGW
    pLV-U6-gRNA-UbC-eGFP-P2A-BsreGFP, BsrhUbCBlasticidin Gersbach CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853. Lentiviral SpCas9-gRNA expression vector with eGFP-P2A-BlastR FUGW
    pPB-US-ECasEERT2-spCas9-ERT2 (Other)U6 (gRNA), EF1a (ERT2-Cas9-ERT2)Puromycin Chen Chen lab CRISPR plasmids (unpublished) Piggyac transposon containing tamoxifen inducible Cas9 and a gRNA cassette. Piggybac Transposon
    pCRISPR-S12hSpCas9 (Other), eGFP (Other)CMV, CMV (downstream of F2A self-cleaving peptide)Puromycin, Hygromycin Wu An episomal CRISPR/Cas9 system to derive vector-free gene modified mammalian cells. Protein Cell. 2016 Sep;7(9):689-91. doi: 10.1007/s13238-016-0299-9. To episomally express codon optimized Cas9 and chimeric guide RNA pCEP4
    pX601-mCherrymCherryT2A Kan Genome editing using CRISPR-Cas9 to create the HPFH genotype in HSPCs: An approach for treating sickle cell disease and beta-thalassemia. Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6. Staphylococcus aureus (SaCas9) conjugated with mCherry pX601
    pX601-GFPGFP (Other) Kan Genome editing using CRISPR-Cas9 to create the HPFH genotype in HSPCs: An approach for treating sickle cell disease and beta-thalassemia. Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6. Staphylococcus aureus (SaCas9) conjugated with GFP pX601
    iCasCas9 (Other)CMVOFP expression Tan A chemical-inducible CRISPR-Cas9 system for rapid control of genome editing. Nat Chem Biol. 2016 Sep 12. doi: 10.1038/nchembio.2179. Expression of SpCas9 with 4 ERT2 fusion protein and empty gRNA cassette. The activity of Cas9 can be switched on and off in human cells with 4-hydroxytamoxifen (4-HT) GeneArt CRISPR Nuclease vector with OFP reporter
    pY108 (lenti-AsCpf1)huAsCpf1 (Synthetic), puromycin resistance gene (Synthetic)EFSPuromycin Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Lenti virus delivery of AsCpf1 and crRNA guide pHKO_23
    pY109 (lenti-LbCpf1)huLbCpf1 (Synthetic), puromycin resistance gene (Synthetic)EFSPuromycin Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Lenti virus delivery of LbCpf1 and crRNA guide pHKO_23
    pY026huAsCpf1 (Synthetic)CMV Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Expresses huAsCpf1 and crRNA guide pcDNA3.1
    pY027huLbCpf1 (Synthetic)CMV Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Expresses huLbCpf1 and crRNA guide pcDNA3.1
    pY094huAsCpf1 (Synthetic), GFP (Synthetic)CMV Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Expresses huAsCpf1-T2A-GFP and crRNA guide pcDNA3.1
    pY095huLbCpf1 (Synthetic), GFP (Synthetic)CMV Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Expresses huLbCpf1-T2A-GFP and crRNA guide pcDNA3.1
    pY30huAsCpf1 (Synthetic), puromycin resistance gene (Synthetic)CMVPuromycin Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Expresses huAsCpf1-P2A-puro and crRNA guide pcDNA3.1
    pY31huLbCpf1 (Synthetic), puromycin resistance gene (Synthetic)CMVPuromycin Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Expresses huLbCpf1-P2A-puro and crRNA guide pcDNA3.1
    Lenti-AsCpf1-BlastAsCpf1 (Other)EFS-NSBlasticidin Kim In vivo high-throughput profiling of CRISPR-Cpf1 activity. Nat Methods. 2016 Dec 19. doi: 10.1038/nmeth.4104. Expresses human codon-optimized AsCpf1 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. lentiCas9-Blast(Addgene#:52962)
    Lenti-LbCpf1-BlastLbCpf1 (Other)EFS-NSBlasticidin Kim In vivo high-throughput profiling of CRISPR-Cpf1 activity. Nat Methods. 2016 Dec 19. doi: 10.1038/nmeth.4104. Expresses human codon-optimized LbCpf1 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. lentiCas9-Blast(Addgene#:52962)
    pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova) loxP-stop-loxP (Other) Iwasato Supernova: A Versatile Vector System for Single-Cell Labeling and Gene Function Studies in vivo. Sci Rep. 2016 Oct 24;6:35747. doi: 10.1038/srep35747. This plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9. pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene Plasmid #42230)
    Lenti-iCas9-neoFlag-iCas9-P2A-GFP (Other)Neomycin (select with G418) Yan An easy and efficient inducible CRISPR/Cas9 platform with improved specificity for multiple gene targeting. Nucleic Acids Res. 2016 Nov 2;44(19):e149. Epub 2016 Jul 25. Lentiviral vector encoding a doxycycline inducible EGFP reporter downstream of FLAG-tagged spCas9, separated by a P2A self-cleavage sequence pInducer-20
    Lenti-multi-CRISPRPuromycin Yan An easy and efficient inducible CRISPR/Cas9 platform with improved specificity for multiple gene targeting. Nucleic Acids Res. 2016 Nov 2;44(19):e149. Epub 2016 Jul 25. Lentiviral vector for the delivery of multiple sgRNAs targeting different genes with constitutive Cas9 expression Lenti-CRISPR
    pAAV-RSV-SpCas9pRSV (Other)pRSV Lei The CRISPR/Cas9-created MDM2 T309G enhances vitreous-induced expression of MDM2 and proliferation and survival of cells. J Biol Chem. 2016 May 31. pii: jbc.M116.729467. Express SpCas9 in mammalian cells pAAV
    pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPREU6-modified-sgRNA-Backbone-EFS-hSaCas9-2xNLS-2A-Puro (Synthetic)Puromycin Regev A Distinct Gene Module for Dysfunction Uncoupled from Activation in Tumor-Infiltrating T Cells. Cell. 2016 Sep 8;166(6):1500-1511.e9. doi: 10.1016/j.cell.2016.08.052. Lentiviral vector encoding modified SaCas9 system backbone bearing BsmBI site for new guide RNAs and puromycin selection marker. pLKO
    FUCas9Cyanhumanised S.pyrogenes Cas9 (Other)hUBC Herold (unpublished) Expresses Cas9 with fluorescent Cyan reporter FUGW
    FUCas9GFPhumanised S.pyogenes Cas9 (Other)hUBC Herold (unpublished) Expresses Cas9 with green fluorescent reporter FUGW
    pLenti-Cas9-GFPCas9-GFP (Synthetic)EFS Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9-GFP pLentiCRISPR v1
    pY036_ATP1A1_G3_ArrayATP1A1 G3 crRNA + user-specified crRNA + AsCpf1-3xHA (Other)CBh Doyon Marker-free coselection for CRISPR-driven genome editing in human cells. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265. Vector for expression of a CRISPR/AsCpf1 array containing the ATP1A1 G3 guide in combination with a user-specified guide. Cloning of oligos for the second guide using BbsI sites. PY036-like plasmid pY036-U6-crRNA(BbsI)-CBh-AsCpf1
    pY036_ATP1A1_G5_ArrayATP1A1 G5 crRNA + user-specified crRNA + AsCpf1-3xHA (Other)CBh Doyon Marker-free coselection for CRISPR-driven genome editing in human cells. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265. Vector for expression of a CRISPR/AsCpf1 array containing the ATP1A1 G5 guide in combination with a user-specified guide. Cloning of oligos for the second guide using BbsI sites. PY036-like plasmid pY036-U6-crRNA(BbsI)-CBh-AsCpf1
    pAAV-Neo_CAG-Cas9Cas9 (Other)pCagNeomycin (select with G418) Vallier Optimized inducible shRNA and CRISPR/Cas9 platforms for in vitro studies of human development using hPSCs. Development. 2016 Dec 1;143(23):4405-4418. Cas9 expression vector for targeting to the AAVS1 locus AAVS1-SA-2A-NEO-CAG-RTTA3 Addgene 60431
    Hygro-Cas9 donorhSpCas9 (Other)Hygromycin Huangfu Genome Editing in hPSCs Reveals GATA6 Haploinsufficiency and a Genetic Interaction with GATA4 in Human Pancreatic Development. Cell Stem Cell. 2017 Feb 8. pii: S1934-5909(17)30001-2. doi: 10.1016/j.stem.2017.01.001. Donor vector for genomic targeting of a Tetracycline-inducible Cas9 cassette to the human AAVS1/PPP1R12C locus with hygromycin selection N/A
    pU6-(BbsI)sgRNA_CAG-Cas9-venus-bpACas9-venus (Synthetic)CAG Kuehn Kuehn -sgRNA plasmids (unpublished) For cloning and expression of sgRNA together with expression of a Cas9-Venus fusion protein Bluescript
    pU6-(BbsI)sgRNA_CAG-Cas9-bpA_EF1-TagRFPCas9 (Other)CAG Kuehn Kuehn -sgRNA plasmids (unpublished) For cloning and expression of sgRNA together with expression of Cas9 and TagRFP Bluescript
    pCAG-1BPNLS-Cas9-1BPNLS1BPNLS-Cas9-1BPNLS (Synthetic)CAG Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. BPNLS-Cas9-BPNLS expression plasmid pCAG
    pCAG-1BPNLS-Cas9-1BPNLS-2AGFP1BPNLS-Cas9-1BPNLS-2A-EGFP (Synthetic)CAG Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. BPNLS-Cas9-BPNLS-2AGFP expression plasmid pCAG
    pAAV-nEFCas9nEF-Cas9 (Synthetic) Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. SpCas9 expression AAV backbone plasmid under control of nEF promoter PX551
    lenti-Cas9-VQR-BlastSpCas9-VQR(D1135V,R1335Q,T1337R) (Other)Blasticidin Bauer Variant-aware saturating mutagenesis using multiple Cas9 nucleases identifies regulatory elements at trait-associated loci. Nat Genet. 2017 Feb 20. doi: 10.1038/ng.3793. lentiviral expression of SpCas9-VQR (NGA PAM restricted) lentiCas9-Blast
    P628_SpCas9-RecARecA (Synthetic)CBh Luo Fusion of SpCas9 to E. coli Rec A protein enhances CRISPR-Cas9 mediated gene knockout in mammalian cells. J Biotechnol. 2017 Mar 1;247:42-49. doi: 10.1016/j.jbiotec.2017.02.024. Human codon optimized RecA protein was fused to SpCas9 for enhanced genome editing efficiency PX459
    P823_eSpCas9(1.1)-RecARecACBh Luo Fusion of SpCas9 to E. coli Rec A protein enhances CRISPR-Cas9 mediated gene knockout in mammalian cells. J Biotechnol. 2017 Mar 1;247:42-49. doi: 10.1016/j.jbiotec.2017.02.024. Human codon optimized RecA protein was fused to eSpCas9(1.1) for enhanced genome editing efficiency eSpCas9(1.1)
    TLCV2Cas9-2A-eGFPTight TRE promoter, Tight TRE promoterPuromycin Karpf Pan-Cancer Analyses Reveal Genomic Features of FOXM1 Overexpression in Cancer. Cancers (Basel). 2019 Feb 21;11(2). pii: cancers11020251. doi: 10.3390/cancers11020251. LentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression. lentiCRISPR v2
  • Tag / Fusion Protein
    • Cas9-T2A-eGFP
  • pCSDest2-NmeCas9-NLS-3XHA-NLSNme Cas9 (Other)CMV Sontheimer Naturally Occurring Off-Switches for CRISPR-Cas9. Cell. 2016 Dec 15;167(7):1829-1838.e9. doi: 10.1016/j.cell.2016.11.017. Epub 2016 Dec 8. Mammalian expression of wild type Nme Cas9 pCSDest2
    SIN-CMV-Ca9-WPREspCas9 (Other)CMV Déglon The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991 Transfer plasmid for the production of lentiviral vectors SIN lentiviral transfer vector
    SIN-PGK-Cas9-V5-WPREspCas9 (Other)mouse PGK Déglon The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991 To produce lentiviral vector for Cas9 editing SIN lentiviral transfer vector
    SIN-PGK-Cas9-WPREhCas9 (Other)mouse PGK Déglon The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991 To produce Lentiviral vector for gene editing HIV-1 lentiviral SIN transfer vector
    SIN-CMV-Cas9-V5-WPRECas9-V5 (Other)CMV Déglon The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991 To produce lentiviral vector for gene editing HIV-1 SIN lentiviral transfer vector
    pTE4254St chimeric gRNA, hStCas9human U6, CMVNeomycin (select with G418) Welker Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. Expresses St chimeric gRNA and human codon-optimized StCas9 pcDNA3.3-TOPO
    pKS7107Nm crRNA, Nm tracrRNA, hNmCas9human U6, human U6, EF1a Welker Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. Expresses Nm crRNA, Nm tracrRNA and human codon-optimized NmCas9 pSimpleII
    pcDNA3.1-hAsCpf1(TYCV) (pY210)Acidaminococcus sp. Cpf1 (RR variant) (Synthetic)CMV Zhang Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. Expresses humanized AsCpf1 variant that recognizes TYCV PAMs pcDNA3.1
    pAsCpf1(TYCV)(BB) (pY211)Acidaminococcus sp. Cpf1 (RR variant) (Synthetic)CBh Zhang Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. Expresses humanized AsCpf1 TYCV PAM variant and crRNA guide pUC ori vector
    pcDNA3.1-hAsCpf1(TATV) (pY220)Acidaminococcus sp. Cpf1 (RVR variant) (Synthetic)CMV Zhang Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. Expresses humanized AsCpf1 variant that recognizes TATV PAMs pcDNA3.1
    pAsCpf1(TATV)(BB) (pY221)Acidaminococcus sp. Cpf1 (RVR variant) (Synthetic)CBh Zhang Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. Expresses humanized AsCpf1 TATV PAM variant and crRNA guide pUC ori vector
    pcDNA3.1-hLbCpf1(TYCV) (pY230)Lachnospiraceae bacterium Cpf1 (RR variant) (Synthetic)CMV Zhang Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. Expresses humanized LbCpf1 variant that recognizes TYCV PAMs pcDNA3.1
    L40C-CRISPR.EFS.dTomato Heckl CRISPR-Cas9-induced t(11;19)/MLL-ENL translocations initiate leukemia in human hematopoietic progenitor cells in vivo. Haematologica. 2017 Jun 1. pii: haematol.2017.164046. doi: 10.3324/haematol.2017.164046. Lentiviral CRISPR-Cas9 delivery for sgRNA (hU6), dTomato coexpression, EFS Promoter driven SIN40C
    L40C-CRISPR.EFS.PACPuromycin Heckl CRISPR-Cas9-induced t(11;19)/MLL-ENL translocations initiate leukemia in human hematopoietic progenitor cells in vivo. Haematologica. 2017 Jun 1. pii: haematol.2017.164046. doi: 10.3324/haematol.2017.164046. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), PAC (Puromycin resistance) coexpression, EFS Promoter driven SIN40C
    pRGEN-CMV-CjCas9Cas9 derived from Campylobacter jejuni (Other) Kim In vivo genome editing with a small Cas9 orthologue derived from Campylobacter jejuni. Nat Commun. 2017 Feb 21;8:14500. doi: 10.1038/ncomms14500. Expression of CjCas9 in mammalian cells pcDNA3.1
    CAG-Cas9hCas9 (Other)CAG Otonkoski Generation of an OCT4 reporter human induced pluripotent stem cell line using CRISPR/SpCas9. Stem Cell Res. 2017 Aug;23:105-108. doi: 10.1016/j.scr.2017.07.006. Epub 2017 Jul 11. Expresses high levels of WT Cas9 for genome editing pCAG
    CAG-SaCas9-WPRESaCas9 (Other)CAG Otonkoski Generation of a SOX2 reporter human induced pluripotent stem cell line using CRISPR/SaCas9. Stem Cell Res. 2017 Jul;22:16-19. doi: 10.1016/j.scr.2017.05.005. Epub 2017 May 17. Expresses high levels of WT SaCas9 for genome editing pCAG NEWENTRY
    DD-Cas9 with filler sequence and Venus (EDCPV)Cas9 (Synthetic)EFS Sordella Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization. Nat Commun. 2017 Feb 22;8:14370. doi: 10.1038/ncomms14370. This plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be remove for cloning of desired sgRNA lentiCRISPR v2
    DD-Cas9 with filler sequence and Cre-ERT2 (EDCICE)Cas9 (Synthetic)EFS Sordella Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization. Nat Commun. 2017 Feb 22;8:14370. doi: 10.1038/ncomms14370. This plasmid contains destabilized Cas9 and has Cre-ERT2 after IRES sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNA lentiCRISPR v2
    pSpCas9(BB)-2A-miRFP670hSpCas9-2A-miRFP670 (Synthetic), BB-guide RNA (Synthetic)Cbh, U6 Kuehn pSpCas9(BB)-2A-miRFP670 (unpublished) Cas9 from S. pyogenes with 2A-miRFP670, and cloning backbone for sgRNA. Modified Zhang Plasmid #62988 PX459
    LcV2-HygroHygromycin Mendell An Argonaute phosphorylation cycle promotes microRNA-mediated silencing. Nature. 2017 Feb 9;542(7640):197-202. doi: 10.1038/nature21025. Epub 2017 Jan 23. LentiCRISPR v2 with Hygro cloned in place of Puro LentiCRISPR v2
    pX330-Flag-SpCas9-HF1 (without sgRNA)3xFlag-NLS-Streptococcus pyogenes Cas9-HF1-NLS (Other)Cbh Welker Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. Expression plasmid for human codon-optimized high-fidelity SpCas9-HF1, px330-like backbone (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
    HeFm1SpCas93xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity mut1 Cas9-NLS (Other)Cbh Welker Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. Expression plasmid for human codon-optimized increased fidelity HeFm1SpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
    HeFm2SpCas9“Highly enhanced Fidelity” mut2 SpCas9 (Other)Cbh Welker Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. Expression plasmid for human codon-optimized increased fidelity HeFm2SpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
    pY111 (pcDNA3.1-huTsCpf1)huTsCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized TsCpf1 pcDNA3.1
    pY112 (pcDNA3.1-huSaCpf1)huSaCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized SaCpf1 pcDNA3.1
    pY113 (pcDNA3.1-huPb2Cpf1)huPb2Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Pb2Cpf1 pcDNA3.1
    pY114 (pcDNA3.1-huPgCpf1)huPgCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized PgCpf1 pcDNA3.1
    pY115 (pcDNA3.1-huMlCpf1)huMlCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized MlCpf1 pcDNA3.1
    pY116 (pcDNA3.1-huMb2Cpf1)huMb2Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Mb2Cpf1 pcDNA3.1
    pY117 (pcDNA3.1-huMb3Cpf1)huMb3Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Mb3Cpf1 pcDNA3.1
    pY118 (pcDNA3.1-huLb4Cpf1)huLb4Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Lb4Cpf1 pcDNA3.1
    pY119 (pcDNA3.1-huLb5Cpf1)huLb5Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Lb5Cpf1 pcDNA3.1
    pY120 (pcDNA3.1-huFbCpf1)huFbCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized FbCpf1 pcDNA3.1
    pY122 (pcDNA3.1-huCPbCpf1)huCPbCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized CPbCpf1 pcDNA3.1
    pY123 (pcDNA3.1-huCMaCpf1)huCMaCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized CMaCpf1 pcDNA3.1
    pY124 (pcDNA3.1-huBsCpf1)huBsCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized BsCpf1 pcDNA3.1
    pY125 (pcDNA3.1-huBfCpf1)huBfCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized BfCpf1 pcDNA3.1
    pY126 (pcDNA3.1-huBoCpf1)huBoCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized BoCpf1 pcDNA3.1
    pY127 (pcDNA3.1-U6-huTsCpf1)huTsCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized TsCpf1 and crRNA pcDNA3.1
    pY128 (pcDNA3.1-U6-huMb2Cpf1)huMb2Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Mb2Cpf1 and crRNA pcDNA3.1
    pY129 (pcDNA3.1-U6-huMb3Cpf1)huMb3Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Mb3Cpf1 and crRNA pcDNA3.1
    pY130 (pcDNA3.1-U6-huBsCpf1)huBsCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized BsCpf1 and crRNA pcDNA3.1
    pX330-Flag-wtSpCas9 (without sgRNA)3xFlag-NLS-wild-type SpCas9-NLS (Other)Cbh Welker Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. Expression plasmid for human codon-optimized wild-type SpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
    pX330-Flag-eSpCas9 (without sgRNA)3xFLAG-NLS-Streptococcus pyogenes enhanced Cas9-NLS (Other)Cbh Welker Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. Expression plasmid for human codon-optimized high-fidelity eSpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
    HeFSpCas93xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity Cas9-NLS (Other)Cbh Welker Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. Expression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
    pCAG Cas9-2A-CitrineCas9 2A Citrine (Other) Sauka-Spengler Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. CAG-driven ubiquitous expression of Cas9. Contains 2A-Citrine reporter. For CRISPR mediated gene knockouts in chicken embryos. pCAG
    pTK Cas9-2A-CitrineCas9 2A Citrine (Other)thymidine kinase promoter Sauka-Spengler Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. Enhancer/reporter plasmid for tissue-specific expression of Cas9 with 2A-Citrine reporter. Contains BsmBI-flanked LacZ cloning cassette for rapid GoldenGate-based cloning of specific enhancers. pTK
    pCI Cas9 H2B-RFPCas9 (Other)CAG Sauka-Spengler Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. CAG-driven ubiquitous expression of Cas9 with Histone2B-RFP reporter controlled by IRES pCI IRES H2B RFP
    pXPR_206Puromycin Root Orthologous CRISPR-Cas9 enzymes for combinatorial genetic screens. Nat Biotechnol. 2018 Feb;36(2):179-189. doi: 10.1038/nbt.4048. Epub 2017 Dec 18. for SaCas9 knockout, lentiviral expression of SaCas9 and gRNA scaffold pXPR
    pPapiPuromycin ; (located downstream of SaCas9-2A sequence) Root Orthologous CRISPR-Cas9 enzymes for combinatorial genetic screens. Nat Biotechnol. 2018 Feb;36(2):179-189. doi: 10.1038/nbt.4048. Epub 2017 Dec 18. lentiviral expression of SaCas9 and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in Stable SpCas9 expressing cell lines for dual Cas9 "Big Papi" screens. Alt name pXPR207. pXPR
    pLX_311-Cas9Cas9 (Other)EF1aBlasticidin Hahn Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014 Sep 3. doi: 10.1038/nbt.3026. for Cas9 knockout, lentiviral expression of Cas9. Alternate plasmid name: pXR111 pXPR
    AAV_Efs_hSpCas9_NLS_FLAG-SV40humanized S. pyogenes Cas9 (Synthetic)EFS Yang Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76. AAV vector for encoding a human codon-optimized SpCas9 driven by EFs promoter pAAV
  • Tag / Fusion Protein
    • Flag (C terminal on insert)
  • Lenti_Efs_hSpCas9_NLS_FLAG-WPREhumanized S. pyogenes Cas9 (Synthetic)EFS Yang Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76. Lentiviral vector for encoding a human codon-optimized SpCas9 driven by EFs promoter. Lenti virus
  • Tag / Fusion Protein
    • Flag (C terminal on insert)
  • lentiCRISPRv2 puroP2A-puroEF-1aPuromycin Stringer A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. Variant of lentiCRISPRv2 that confers puromycin resistance lentiCRISPRv2
    lentiCRISPRv2 hygroP2A-hygroEF-1aHygromycin Stringer A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. Variant of lentiCRISPRv2 that confers hygromycin resistance lentiCRISPRv2
    lentiCRISPRv2 neoP2a-neoEF-1aNeomycin (select with G418) Stringer A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. Variant of lentiCRISPRv2 that confers G418 resistance lentiCRISPRv2
    lentiCRISPRv2 blastP2a-blastEF-1aBlasticidin Stringer A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. Variant of lentiCRISPRv2 that confers blasticidin S resistance lentiCRISPRv2
    px330-mcherryU6mCherry Li Correction of a genetic disease in mouse via use of CRISPR-Cas9. Cell Stem Cell. 2013 Dec 5;13(6):659-62. doi: 10.1016/j.stem.2013.10.016. Cas9 from S.pyogenes with CMV-mcherry cassette, and cloning backbone for sgRNA pX330
    pCAGG>nls-hCas9-nlshumanized Cas9Chicken beta actin (CAG) Bronner Optimization of CRISPR/Cas9 genome editing for loss-of-function in the early chick embryo. Dev Biol. 2017 Dec 1;432(1):86-97. doi: 10.1016/j.ydbio.2017.08.036. Expresses Cas9 via the chicken beta actin promoter for electroporation in chicken embryos pCI
    pCAGG>nls-hCas9-nls-GFPCas9-GFPChicken beta actin (CAG) Bronner Optimization of CRISPR/Cas9 genome editing for loss-of-function in the early chick embryo. Dev Biol. 2017 Dec 1;432(1):86-97. doi: 10.1016/j.ydbio.2017.08.036. Cas9-GFP fusion protein under the regulation of chicken beta-actin promoter pCI
    LentiCRISPRv2-mCherryCas9 (Synthetic), mCherry (Other)EFS-NS, EFS-NSmCherry Smogorzewska LentiCRISPRv2-mCherry (unpublished) Lentiviral vector encoding sgRNA cloning site + hSpCAS9-P2A-mCherry. LentiCRISPRv2
    CROPseq-Guide-EFS-SpCas9-P2A-EGFPEFS Hewitt CROPseq-Guide-EFS-SpCas9-P2A-EGFP (unpublished) single-vector system with EGFP reporter for use in CROPseq knockout screens CROPseq-Guide-Puro
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)
  • ciCas9_pcDNA5ciCas9Hygromycin Maly Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368. Expresses ciCas9 in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables. pcDNA5/FRT/TO
    e-ciCas9_pcDNA5e-ciCas9Hygromycin Maly Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368. Expresses enhanced specificity ciCas9 (e-ciCas9) in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables. pcDNA5/FRT/TO
    eSpCas9(1.1)-T2A-PuroCBhPuromycin Németh eSpCas9(1.1)-T2A-Puro (unpublished) Enhanced SpCas9(1.1) with puromycin resistance gene via T2A linker. eSpCas9(1.1)
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • T2A-Puro (C terminal on insert)
  • BPK3258 - human expression plasmid for eSpCas9(1.1)hSpCas9-eSpCas9(1.1)(K848A/K1003A/R1060A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 eSpCas9(1.1) variant: CMV-T7-hSpCas9-eSpCas9(1.1)(K848A, K1003A, R1060A)-NLS(SV40)-3xFLAG JDS246
    BPK3274 - human expression plasmid for eSpCas9(1.1)-HF1hSpCas9-eSpCas9(1.1)-HF1(N497A/R661A/Q695A/K848A/Q926A/K1003A/R1060A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant: CMV-T7-hSpCas9-eSpCas9(1.1)-HF1(N497A, R661A, Q695A, K848A, Q926A, K1003A, R1060A)-NLS(SV40)-3xFLAG JDS246
    BPK4410 - human expression plasmid for SpCas9 Cluster 1 (HypaCas9)hSpCas9-Cluster1(N692A/M694A/Q695A/H698A)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 variant (HypaCas9): CMV-T7-hSpCas9-Cluster1(N692A, M694A, Q695A, H698A)-NLS(SV40)-3xFLAG JDS246
    MMW3709 - human expression plasmid for SpCas9 Cluster 1 + Q926AhSpCas9-Cluster1+Q926A(N692A/M694A/Q695A/H698A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 + Q926A variant: CMV-T7-hSpCas9-Cluster1+Q926A(N692A, M694A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3914 - human expression plasmid for SpCas9 Cluster 1 H698 + Q926AhSpCas9-Cluster1H698+Q926A(N692A/M694A/Q695A/Q926A)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 H698 + Q926A variant: CMV-T7-hSpCas9-Cluster1H698+Q926A(N692A, M694A, Q695A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3689 - human expression plasmid for SpCas9 Cluster 1 Q695 + Q926AhSpCas9-Cluster1Q695+Q926A(N692A/M694A/H698A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 Q695 + Q926A variant: CMV-T7-hSpCas9-Cluster1Q695+Q926A(N692A, M694A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3911 - human expression plasmid for SpCas9 Cluster 1 M694 + Q926AhSpCas9-Cluster1M694+Q926A(N692A/Q695A/H698A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 M694 + Q926A variant: CMV-T7-hSpCas9-Cluster 1M694+Q926A(N692A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3909 - human expression plasmid for SpCas9 Cluster 1 N692 + Q926AhSpCas9-Cluster1N692+Q926A(M694A/Q695A/H698A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 N692 + Q926A variant: CMV-T7-hSpCas9-Cluster1N692+Q926A(M694A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3001 - human expression plasmid for SpCas9 Cluster 2 + Q926AhSpCas9-Cluster2+Q926A(G582A/V583A/E584A/D585A/N588A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 2 + Q926A variant: CMV-T7-hSpCas9-Cluster2+Q926A(G582A, V583A, E584A, D585A, N588A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW2993 - human expression plasmid for SpCas9 Cluster 2hSpCas9-Cluster2(G582A/V583A/E584A/D585A/N588A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 2 variant: CMV-T7-hSpCas9-Cluster2(G582A, V583A, E584A, D585A, N588A)-NLS(SV40)-3xFLAG JDS246
    MMW3645 - human expression plasmid for SpCas9 Cluster 3hSpCas9-Cluster3(T657A/G658A/W659A/R661A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 3 variant: CMV-T7-hSpCas9-Cluster3(T657A, G658A, W659A, R661A)-NLS(SV40)-3xFLAG JDS246
    MMW3629 - human expression plasmid for SpCas9 Cluster 3 + Q926AhSpCas9-Cluster3+Q926A(T657A/G658A/W659A/R661A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 3 + Q926A variant: CMV-T7-hSpCas9-Cluster3+Q926A(T657A, G658A, W659A, R661A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3770 - human expression plasmid for SpCas9 Cluster 4hSpCas9-Cluster4(F491A/M495A/T496A/N497A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 4 variant: CMV-T7-hSpCas9-Cluster4(F491A, M495A, T496A, N497A)-NLS(SV40)-3xFLAG JDS246
    MMW3759 - human expression plasmid for SpCas9 Cluster 4 + Q926AhSpCas9-Cluster4+Q926A(F491A/M495A/T496A/N497A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 4 + Q926A variant: CMV-T7-hSpCas9-Cluster4+Q926A(F491A, M495A, T496A, N497A, Q926A)-NLS(SV40)-3xFLAG JDS246
    BPK4387 - human expression plasmid for SpCas9 Cluster 5hSpCas9-Cluster5(K918A/V922A/R925A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 5 variant: CMV-T7-hSpCas9-Cluster5(K918A, V922A, R925A)-NLS(SV40)-3xFLAG JDS246
    BPK4393 - human expression plasmid for SpCas9 Cluster 5 + Q926AhSpCas9-Cluster5+Q926A(K918A/V922A/R925A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 5 + Q926A variant: CMV-T7-hSpCas9-Cluster5+Q926A(K918A, V922A, R925A, Q926A)-NLS(SV40)-3xFLAG JDS246
    px459 VQRSpCas9 VQR (Other)Puromycin Holland AID Chapter plasmids (unpublished) sgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM) px459 v2
    px459 VRERSpCas9 VRER (Other)Puromycin Holland AID Chapter plasmids (unpublished) sgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM) px459 v2
    p458 VQRSpCas9 VQR (Other)EGFP Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifs px458
    p458 VRERSpCas9 VRER (Other)EGFP Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifs px458
    px330 VRERSpCas9 VRER (Other) Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifs px330
    p330 VQRSpCas9 VQR (Other) Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifs px330
    px458 EQRSpCas9 EQR (Other)EGFP Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifs px458
    px459 EQRSpCas9 EQR (Other)Puromycin Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifs px459 v2
    px330 EQRSpCas9 EQR (Other) Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifs px330
    pLCRISPR-CMV Manel Transmission of innate immune signaling by packaging of cGAMP in viral particles. Science. 2015 Sep 11;349(6253):1232-6. doi: 10.1126/science.aab3628. Epub 2015 Jul 30. Control lentivector expressing Cas9 and gRNA scaffold pLCRISPR
    PCS2+Cas9-mSACAS9-MSA (Other)SP6 Rossant Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. Cas9 mSA for in vitro transcription for gene editing in Mouse Embryos PCS2+
    p3s-Cas9-HNCas9-WT (Other)CMV Kim Rescue of high-specificity Cas9 variants using sgRNAs with matched 5' nucleotides. Genome Biol. 2017 Nov 15;18(1):218. doi: 10.1186/s13059-017-1355-3. Cas9-WT mammalian expression p3s
  • Tag / Fusion Protein
    • HA (N terminal on backbone)
  • p3s-eCas9-1.1eCas9-1.1 (Other)CMV Kim Rescue of high-specificity Cas9 variants using sgRNAs with matched 5' nucleotides. Genome Biol. 2017 Nov 15;18(1):218. doi: 10.1186/s13059-017-1355-3. eCas9-1.1 mammalian expression p3s
  • Tag / Fusion Protein
    • HA (N terminal on backbone)
  • p3s-Cas9-HF1Cas9-HF1 (Other)CMV Kim Rescue of high-specificity Cas9 variants using sgRNAs with matched 5' nucleotides. Genome Biol. 2017 Nov 15;18(1):218. doi: 10.1186/s13059-017-1355-3. Cas9-HF1 mammalian expression p3s
  • Tag / Fusion Protein
    • HA (N terminal on backbone)
  • pAAV-EFS-SpCas9Streptococcus pyogenes Cas9 (Synthetic)EFS Yasuda Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain. Neuron. 2017 Oct 18. pii: S0896-6273(17)30933-9. doi: 10.1016/j.neuron.2017.10.004. AAV vector expressing Myc-tagged SpCas9 under the EFS promoter PX551
    lenti-SpCas9 puroKpnI-XhoI-BsrGI-NheI (Synthetic)Puromycin Stringer A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. This 3rd generation lentiviral construct delivers hSpCas9 and puromycin resistance. lentiCRISPRv2 puro (Addgene #98290)
    lenti-SpCas9 hygroKpnI-XhoI-BsrGI-NheI (Synthetic)Hygromycin Stringer A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. This lentiviral construct delivers hSpCas9 and hygromycin resistance. lentiCRISPRv2 hygro (Addgene #98291)
    lenti-SpCas9 neoKpnI-XhoI-BsrGI-NheI (Synthetic)Neomycin (select with G418) Stringer A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. This lentiviral construct delivers hSpCas9 and G418 resistance. lentiCRISPRv2 neo (Addgene #98292)
    lenti-SpCas9 blastKpnI-XhoI-BsrGI-NheI (Synthetic)Blasticidin Stringer A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. This lentiviral construct delivers hSpCas9 and blasticidin S resistance. lentiCRISPRv2 blast (Addgene #98293)
    pMB-SaCas9Cas9 nuclease (Other)short EF1alphaHygromycin ; mouse CD4 McManus Dual gene activation and knockout screen reveals directional dependencies in genetic networks. Nat Biotechnol. 2018 Jan 15. pii: nbt.4062. doi: 10.1038/nbt.4062. SaCas9 expression vector pBR322
    pSECBBlasticidin Possemato Serine Catabolism by SHMT2 Is Required for Proper Mitochondrial Translation Initiation and Maintenance of Formylmethionyl-tRNAs Mol. Cell (2018) Volume 69, Issue 4, p610–621.e5 Express spCas9 with sgRNA, blast resistance pSECB
    AAV-CMVc-Cas9Cas9 (Synthetic)CMVc Belmonte In Vivo Target Gene Activation via CRISPR/Cas9-Mediated Trans-epigenetic Modulation. Cell. 2017 Dec 14;171(7):1495-1507.e15. doi: 10.1016/j.cell.2017.10.025. Epub 2017 Dec 7. Expresses SpCas9 from the CMVc promoter in AAV backbone AAV
    CROPseq-EFS-SpCas9-P2A-blastEFSBlasticidin Hewitt CROPseq plasmids (unpublished) single-vector CROPseq system with blasticidin resistance selection for use in the CROPseq CRISPR knockout screens CROPseq-Guide-EFS-SpCas9-P2A-EGFP
    CROPseq-EFS-HypaSpCas9-P2A-EGFPHypaSpCas9 (Synthetic)EFSEGFP Hewitt CROPseq plasmids (unpublished) single-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screen CROPseq-Guide-EFS-SpCas9-P2A-EGFP
    CROPseq-EFS-HypaSpCas9-P2A-puroHypaSpCas9 (Synthetic)EFSPuromycin Hewitt CROPseq plasmids (unpublished) single-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screen CROPseq-Guide-EFS-SpCas9-P2A-puro
    pX551-CMV-SpCas9SpCas9 (Other) Hewitt Alex Hewitt Lab plasmids (unpublished) AAV plasmid expressing Cas9 under control of CMV promoter, by replaceing mecp2 promoter in pX551 from Zhang lab pAAV
    pX551-miniCMV-SpCas9SpCas9 (Other) Hewitt Alex Hewitt Lab plasmids (unpublished) AAV plasmid expressing Cas9 under control of miniCMV promoter pAAV
    pX551-miniCMV-SaCas9SaCas9 (Other) Hewitt Alex Hewitt Lab plasmids (unpublished) AAV plasmid expressing SaCas9 under control of miniCMV promoter pAAV
    pX551-miniCMV-CjCas9CjCas9 (Other) Hewitt Alex Hewitt Lab plasmids (unpublished) AAV plasmid expressing CjCas9 under control of miniCMV promoter pAAV
    pX551-miniCMV-AsCpf1AsCpf1 (Other) Hewitt Alex Hewitt Lab plasmids (unpublished) AAV plasmid expressing AsCpf1 under control of miniCMV promoter pAAV
    pX551-CMV-CjCas9CjCas9 (Other) Hewitt Alex Hewitt Lab plasmids (unpublished) AAV plasmid expressing CjCas9 under control of CMV promoter pAAV
    pX601 miniCMV-SaCas9-SpA-sgRNA scaffold Hewitt Alex Hewitt Lab plasmids (unpublished) Backbone vector for cloning in target sgRNA for use with SaCas9 pAAV
    pSP64T-hLbCpf1hLbCpf1 (Homo sapiens)sp6 Giraldez CRISPR-Cpf1 mediates efficient homology-directed repair and temperature-controlled genome editing. Nat Commun. 2017 Dec 8;8(1):2024. doi: 10.1038/s41467-017-01836-2. plasmid to carry out IVT of human codon optimized LbCpf1 (from Addgene; 69988) pSP64T
    pAAVS1-TRE-Cas9- puro-polyA-CAG-rtTAhSpCas9 (Other), rtTA, bGH polyA-SV40polyATRE, CAGPuromycin Menéndez Generation and characterization of a human iPSC cell line expressing inducible Cas9 in the "safe harbor" AAVS1 locus. (unpublished) Expresses Cas9 upon induction with doxicycline. N/A
    pCSD_1xNLS-SaCas9-1xNLS-3xHA-1xNLSSaCas9 (Other)CMV IE94 Wolfe Orthogonal Cas9-Cas9 chimeras provide a versatile platform for genome editing. Nat Commun. 2018 Nov 19;9(1):4856. doi: 10.1038/s41467-018-07310-x. Expresses SaCas9 in mammalian cells pCSDest2
    pTE3330Lb crRNA, hLbCpf1(RVR mutant)human U6, CMVNeomycin (select with G418) Welker Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. Expresses Lb crRNA and human codon optimized LbCpf1(RVR mutant) in mammalian cells. pcDNA3.1
    pTE3327As crRNA, hAsCpf1(RVR mutant)human U6, CMVNeomycin (select with G418) Welker Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. Expresses As crRNA and human codon optimized AsCpf1(RVR mutant) in mammalian cells. pcDNA3.1
    pTE3331Fn crRNA, hFnCpf1(RVR mutant)human U6, CMVNeomycin (select with G418) Welker Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. Expresses Fn crRNA and human codon optimized FnCpf1(RVR mutant) in mammalian cells. pcDNA3.1
    pTE3334Mb crRNA, hMbCpf1(RVR mutant)human U6, CMVNeomycin (select with G418) Welker Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. Expresses Mb crRNA and human codon optimized MbCpf1(RVR mutant) in mammalian cells. pcDNA3.1
    pTE3329Lb crRNA, hLbCpf1(RR mutant)human U6, CMVNeomycin (select with G418) Welker Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. Expresses Lb crRNA and human codon optimized LbCpf1(RR mutant) in mammalian cells. pcDNA3.1
    pTE3328As crRNA, hAsCpf1(RR mutant)human U6, CMVNeomycin (select with G418) Welker Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. Expresses As crRNA and human codon optimized AsCpf1(RR mutant) in mammalian cells. pcDNA3.1
    pTE3333Fn crRNA, hFnCpf1(RR mutant)human U6, CMVNeomycin (select with G418) Welker Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. Expresses Fn crRNA and human codon optimized FnCpf1(RR mutant) in mammalian cells. pcDNA3.1
    pTE3336Mb crRNA, hMbCpf1(RR mutant)human U6, CMVNeomycin (select with G418) Welker Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. Expresses Mb crRNA and human codon optimized MbCpf1(RR mutant) in mammalian cells. pcDNA3.1
    pX-evoCas9Humanized S. pyogenes Cas9CBh Cereseto A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nat Biotechnol. 2018 Jan 29. pii: nbt.4066. doi: 10.1038/nbt.4066. Expresses the M495V/Y515N/K526E/R661Q (evoCas9) SpCas9 variant in mammalian cells PX330 (Addgene #42230)
    LentiV_Cas9_puroCas9 (Synthetic)EFS promoter, EFS promoterPuromycin Vakoc LKB1, Salt-Inducible Kinases, and MEF2C Are Linked Dependencies in Acute Myeloid Leukemia. Mol Cell. 2018 Feb 28. pii: S1097-2765(18)30109-6. doi: 10.1016/j.molcel.2018.02.011. Lentiviral expression plasmid of spCas9 with puromycin resistance gene LentiV_puro
    pX459V2.0-eSpCas9(1.1)Puromycin Miyaoka Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research pX459 V2.0 (Plasmid #62988) with the K848A, K1003A, and R1060A mutations pX459
    pX459V2.0-SpCas9-HF1Puromycin Miyaoka Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research pX459 V2.0 (Plasmid #62988) with the N497A, R661A, Q695A, and Q926A mutations pX459
    pX459V2.0-HypaCas9Puromycin Miyaoka Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research pX459 V2.0 (Plasmid #62988) with the N692A, M694A, Q695A, and H698A mutations pX459
    pX459V2.0-SpCas9-HF4Puromycin Miyaoka Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research pX459 V2.0 (Plasmid #62988) with the Y450A, N497A, R661A, Q695A, and Q926A mutations pX459
    pX330-SpCas9-HF1 Miyaoka Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research pX330 (Plasmid #42230) with the N497A, R661A, Q695A, and Q926A mutations pX330
    pX330-HypaCas9 Miyaoka Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research pX330 (Plasmid #42230) with the N692A, M694A, Q695A, and H698A mutations pX330
    xCas9 3.7xCas9 3.7 (Synthetic) Liu Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature. 2018 Feb 28. pii: nature26155. doi: 10.1038/nature26155. Mammalian expression vector for xCas9 3.7 pCMV
  • Tag / Fusion Protein
    • NLS (N terminal on insert)
  • xCas9 3.6xCas9 3.6 (Synthetic) Liu Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature. 2018 Feb 28. pii: nature26155. doi: 10.1038/nature26155. Mammalian expression vector for xCas9 3.6 pCMV
  • Tag / Fusion Protein
    • NLS (N terminal on insert)
  • Myh6-Cas9Cas9 (Other)alpha MHC van Rooij Postnatal Cardiac Gene Editing Using CRISPR/Cas9 With AAV9-Mediated Delivery of Short Guide RNAs Results in Mosaic Gene Disruption. Circ Res. 2017 Oct 27;121(10):1168-1181. doi: 10.1161/CIRCRESAHA.116.310370. Epub 2017 Aug 29. Cardiac-specific overexpression of Cas9 alpha MHC
    1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spA Lagor A Self-Deleting AAV-CRISPR System for In Vivo Genome Editing. Mol Ther Methods Clin Dev. 2018 Dec 6;12:111-122. doi: 10.1016/j.omtm.2018.11.009. eCollection 2019 Mar 15. Plasmid for liver-specific expression of AAV SaCas9 with a BbsI cloning site for a gRNA pEMBL8
    1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA Lagor Somatic Editing of Ldlr With Adeno-Associated Viral-CRISPR Is an Efficient Tool for Atherosclerosis Research. Arterioscler Thromb Vasc Biol. 2018 Jul 19. pii: ATVBAHA.118.311221. doi: 10.1161/ATVBAHA.118.311221. Plasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNA pEMBL8
    hSyn1-AsCpf1(RR)hAsCpf1(RR) (Homo sapiens)hSyn1 Zhang Effects of 3D culturing conditions on the transcriptomic profile of stem-cell-derived neurons Nature Biomedical Engineering (Epub 09 April 2018) AAV vector expressing AsCpf1 (RR variant) Custom
    pMIA3EF1a Foo A Roadmap for Human Liver Differentiation from Pluripotent Stem Cells. Cell Rep. 2018 Feb 20;22(8):2190-2205. doi: 10.1016/j.celrep.2018.01.087. Expresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSB px330 (addgene #42230)
  • Tags / Fusion Proteins
    • mRuby2 (N terminal on insert)
    • mtp53dn (N terminal on insert)
  • pCas9-HEHDR-Enhancer domain of human CtIP protein (Homo sapiens)Neomycin (select with G418) Concordet CtIP fusion to Cas9 enhances transgene integration by homology-dependent repair. Nat Commun. 2018 Mar 19;9(1):1133. doi: 10.1038/s41467-018-03475-7. Expresses Cas9 fusion to HE (HDR-enhancer) domain of human CtIP protein hCas9 Addgene ID 41815 RBBP8 COM1, CTIP, JWDS, RIM, SAE2, SCKL2
    pCas9-GemininGeminin (Homo sapiens)Neomycin (select with G418) Concordet CtIP fusion to Cas9 enhances transgene integration by homology-dependent repair. Nat Commun. 2018 Mar 19;9(1):1133. doi: 10.1038/s41467-018-03475-7. Expresses Cas9 fusion to Geminin degron domain hCas9 Addgene ID 41815 GMNN Gem, MGORS6
    pCas9-HE-GemininHE-GemininNeomycin (select with G418) Concordet CtIP fusion to Cas9 enhances transgene integration by homology-dependent repair. Nat Commun. 2018 Mar 19;9(1):1133. doi: 10.1038/s41467-018-03475-7. Expresses Cas9 fusion to HE (HDR-enhancer) domain of human CtIP protein and Geminin degron hCas9 Addgene ID 41815
    pCas9-CtIPCtIP (Homo sapiens)Neomycin (select with G418) Concordet CtIP fusion to Cas9 enhances transgene integration by homology-dependent repair. Nat Commun. 2018 Mar 19;9(1):1133. doi: 10.1038/s41467-018-03475-7. Expresses Cas9 fusion to human CtIP protein hCas9 Addgene ID 41815 RBBP8 COM1, CTIP, JWDS, RIM, SAE2, SCKL2
    pX458_RubyhSpCas9 Hublitz Infection with a Brazilian isolate of Zika virus generates RIG-I stimulatory RNA and the viral NS5 protein blocks type I IFN induction and signaling. Eur J Immunol. 2018 Mar 23. doi: 10.1002/eji.201847483. Cas9 from S. pyogenes with Ruby2, and cloning backbone for sgRNA PX458
    pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNASt1Cas9 LMD-9 (Homo sapiens), sgRNA for St1Cas9 (Homo sapiens)LP1B, hU6 Doyon Versatile and robust genome editing with Streptococcus thermophilus CRISPR1-Cas9. Genome Res. 2020 Jan;30(1):107-117. doi: 10.1101/gr.255414.119. Epub 2020 Jan 3. A single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNA pX602 (Plasmid #61593)
    U6_sgRNA_CAG_hSt1Cas9_LMD9St1Cas9 LMD-9 (Homo sapiens), sgRNA for St1Cas9 (Homo sapiens)CAG, hU6 Doyon Versatile and robust genome editing with Streptococcus thermophilus CRISPR1-Cas9. Genome Res. 2020 Jan;30(1):107-117. doi: 10.1101/gr.255414.119. Epub 2020 Jan 3. A single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNA. MSP1594_2x_NLS (Plasmid #110625)
    pLenti-Cas9-P2A-PuroCas9 (Synthetic)EF1sPuromycin Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for expression of Cas9 in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
    pLenti-VQR-P2A-PuroCas9-VQR (Synthetic)EF1sPuromycin Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for constitutive expression of Cas9-VQR (not codon optimized) Adapted from lentiCRISPRv1
  • Tag / Fusion Protein
    • 3X FLAG (C terminal on insert)
  • pLenti-VQRRA-P2A-PuroCas9-VQRRA (Synthetic)EF1sPuromycin Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)
  • pLenti-VRERRA-P2A-PuroCas9-VRERRA (Synthetic)EF1sPuromycin Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)
  • pLenti-HF1RA-P2A-PuroCas9-HF1RA (Synthetic)EF1sPuromycin Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for constitutive expression of Cas9-HF1RA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)
  • pLenti-VQRRA-PGK-PuroCas9-VQRRA (Synthetic)EF1sPuromycin Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)
  • pLenti-VRERRA-PGK-PuroCas9-VRERRA (Synthetic)EF1sPuromycin Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)
  • pLenti-HF1RA-PGK-PuroCas9-HF1RA (Synthetic)EF1sPuromycin Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for constitutive expression of Cas9-HF1RA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)
  • pLenti-VQRRA-P2A-GFP-PGK-PuroCas9-VQRRA (Synthetic)EF1sPuromycin ; GFP Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for constitutive expression of Cas9-VQRRA-P2A-GFP in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)
  • pLenti-VRERRA-P2A-GFP-PGK-PuroCas9-VRERRA (Synthetic)EF1sPuromycin ; GFP Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for constitutive expression of Cas9-VRERRA-P2A-GFP in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)
  • pLenti-HF1RA-P2A-GFP-PGK-PuroCas9-HF1RA (Synthetic)EF1sPuromycin ; GFP Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for constitutive expression of Cas9-HF1RA-P2A-GFP in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)
  • pLenti-xCas9RA-P2A-PuroxCas9(3.7)RA (Synthetic)EF1sPuromycin Dow Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. Lentiviral vector for constitutive expression of xCas9(3.7)RA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)
  • pEJS654 All-in-One AAV-sgRNA-hNmeCas9sgRNA scaffold, Human-codon-optimized NmeCas9 (Other)U6, U1a Sontheimer All-in-one adeno-associated virus delivery and genome editing by Neisseria meningitidis Cas9 in vivo. Genome Biol. 2018 Sep 19;19(1):137. doi: 10.1186/s13059-018-1515-0. Delivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing. PX551-Plasmid #60957
    pX458-DsRed2DsRed2 (Synthetic) Liang Speed genome editing by transient CRISPR/Cas9 targeting and large DNA fragment deletion. J Biotechnol. 2018 Jun 7;281:11-20. doi: 10.1016/j.jbiotec.2018.06.308. Cloning backbone for sgRNA, co-expresses human optimized S. pyogenes Cas9 and DsRed2 pX458
    pX458-ECFPECFP (Synthetic) Liang Speed genome editing by transient CRISPR/Cas9 targeting and large DNA fragment deletion. J Biotechnol. 2018 Jun 7;281:11-20. doi: 10.1016/j.jbiotec.2018.06.308. Cloning backbone for sgRNA, co-expresses human optimized S. pyogenes Cas9 and ECFP pSpCas9(BB)-2A-GFP (PX458)
    CMV-SpyCas9SpyCas9 Niopek Engineered anti-CRISPR proteins for optogenetic control of CRISPR-Cas9. Nat Methods. 2018 Oct 30. pii: 10.1038/s41592-018-0178-9. doi: 10.1038/s41592-018-0178-9. SpyCas9 expression in mammalian cells (CMV promoter driven) pcDNA3.1
    pAAV-CMV-SpyCas9SpyCas9 Niopek Engineered anti-CRISPR proteins for optogenetic control of CRISPR-Cas9. Nat Methods. 2018 Oct 30. pii: 10.1038/s41592-018-0178-9. doi: 10.1038/s41592-018-0178-9. AAV vector for expression of SpyCas9 in mammalian cells ssAAV vector
    pX330 spCas9-mSACAS9-MSA (Other) Rossant Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. pX330 vector carrying spCas9-mSA for gene editing in mammalian cell lines pX330
    pJEP311-pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pASaCas9Cytomegalo Virus(CMV) Ploski The Development of an AAV-Based CRISPR SaCas9 Genome Editing System That Can Be Delivered to Neurons in vivo and Regulated via Doxycycline and Cre-Recombinase. Front. Mol. Neurosci. (2018) 13 SaCas9 driven by EFS. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS. AAV NEWENTRY
    pJEP313-pAAV-CMV-SaCas9-DIO-pASaCas9Cytomegalo Virus(CMV) Ploski The Development of an AAV-Based CRISPR SaCas9 Genome Editing System That Can Be Delivered to Neurons in vivo and Regulated via Doxycycline and Cre-Recombinase. Front. Mol. Neurosci. (2018) 13 A CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent. AAV NEWENTRY
    p3s-Sniper-Cas9Sniper-Cas9CMV Lee Directed evolution of CRISPR-Cas9 to increase its specificity. Nat Commun. 2018 Aug 6;9(1):3048. doi: 10.1038/s41467-018-05477-x. Expresses Sniper-Cas9 with CMV promoter pCDNA3.1
    pSpCTRE-CD4SpCas9 (Homo sapiens)CD4 Rudin Direct genome editing of patient-derived xenografts using CRISPR-Cas9 enables rapid in vivo functional genomics Nature Cancer Dox-inducible Cas9 expression with a CD4 selection marker pLVX-TetOne-Puro
    pSH231-EFS-Cas9-BlastRCas9-T2A-BlastR (Other)EF1aBlasticidin Monnat New human chromosomal safe harbor sites for genome engineering with CRISPR/Cas9, TAL effector and homing endonucleases bioRxiv 396390 Safe harbor site 231 knock-in vector with Cas9-BlastR expression cassette Piggybac
    pU6-SacB-Cas9-T2A-mCherry_(BbsI)Cas9 (Other), SacB (Other)CBh, U6T2A-mCherry Failor CRISPR-Cas9 system with SacB toxin Positive Selection (unpublished) Encodes Cas9, T2A-mCherry, and AmpR which creates a CRISPR system application with reliable positive selection pX330
    pBC2101-recireci_wtCas9 with SV40 NLS Savage Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528. U6-sgRNA-EFS-Cas9-T2A-mCherry-P2A-Hygro; wtCas9 with NLS Lenti
    pBC2102-recireci_wtCas9 without NLSU6 Promoter Savage Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528. U6-sgRNA-EFS-Cas9-T2A-mCherry-P2A-Hygro; wtCas9 without NLS Lenti
    pBC2103-recireci_arCas9 without NLS Savage Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528. U6-sgRNA-EFS-arC9-T2A-mCherry-P2A-Hygro; arC9 without NLS Lenti
    eSpCas9(1.1)-PuroeSpCas9(1.1) (Synthetic)U6Puromycin Leyns Loss of Emp2 compromises cardiogenic differentiation in mouse embryonic stem cells. Biochem Biophys Res Commun. 2019 Feb 14. pii: S0006-291X(19)30235-9. doi: 10.1016/j.bbrc.2019.02.048. The plasmids pSpCas9 (BB)-2A-Puro (Addgene, #48139) and eSpCas9 (1.1) (Addgene, #71814) were combined to express both “enhanced specificity” Cas9 and puromycin resistance protein. pSpCas9(BB)-2A-Puro
    pScCas9Streptococcus canis Cas9 (Other)EF-1α Jacobson Minimal PAM specificity of a highly similar SpCas9 ortholog. Sci Adv. 2018 Oct 24;4(10):eaau0766. doi: 10.1126/sciadv.aau0766. eCollection 2018 Oct. Mammalian expression vector encoding WT ScCas9 OG3569
    pX330-SpCas9-NGSpCas9-NG (L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) Nureki Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science. 2018 Aug 30. pii: science.aas9129. doi: 10.1126/science.aas9129. Expresses 3xFLAG-NLS-SpCas9-NG-NLS in mammalian cells. pX330
    pLex_Cas9Cas9-P2A-NLS-BASTR (Other)Blasticidin Khavari Coupled Single-Cell CRISPR Screening and Epigenomic Profiling Reveals Causal Gene Regulatory Networks. Cell. 2018 Dec 11. pii: S0092-8674(18)31514-9. doi: 10.1016/j.cell.2018.11.022. pLex_Cas9 is a single insert lentiviral vector expressing Cas9 driven by CMV promoter. pLex
    pLX311-Cas9Cas9 (Other)EF1alphaBlasticidin Hahn Mutational processes shape the landscape of TP53 mutations in human cancer. Nat Genet. 2018 Oct;50(10):1381-1387. doi: 10.1038/s41588-018-0204-y. Constitutive expression of Cas9 pLX311
    pSpCas9(BB)-2A-BlastBlasticidin Takemaru pSpCas9(BB)-2A-Blast (unpublished) Used for expression of sgRNA in mammalian cells pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene#62988)
    pSpCas9(BB)-T2A-HygRhSpCas9-T2A-HygR (Homo sapiens)CAG and U6Hygromycin Ferrer Human pancreatic islet three-dimensional chromatin architecture provides insights into the genetics of type 2 diabetes. Nat Genet. 2019 Jun 28. pii: 10.1038/s41588-019-0457-0. doi: 10.1038/s41588-019-0457-0. SpCas9 expression vector pX458
  • Tag / Fusion Protein
    • 3XFLAG (N terminal on insert)
  • pCAG-SpCas9-2A-GFP-noITRCas9 (Other) Denham A Modified Monomeric Red Fluorescent Protein Reporter for Assessing CRISPR Activity. Front Cell Dev Biol. 2018 May 15;6:54. doi: 10.3389/fcell.2018.00054. eCollection 2018. Cas9 GFP plasmid constitutively expressed from CAG promoter. AAV repeat region removed to increase expression pSpCas9(BB)-2A-GFP (PX458)
    HF-PX459 (V2)hSpCas9-HF1-2A-Puro V2.0 (Synthetic)CbhPuromycin McGrew High fidelity CRISPR/Cas9 increases precise monoallelic and biallelic editing events in primordial germ cells. Sci Rep. 2018 Oct 11;8(1):15126. doi: 10.1038/s41598-018-33244-x. Plasmid encoding SpCas9-HF1, a single guide RNA and puromycin resistance PX459
    Lenti_SaCRISPR_GFPU6GFP Vakoc A Transcription Factor Addiction in Leukemia Imposed by the MLL Promoter Sequence. Cancer Cell. 2018 Dec 10;34(6):970-981.e8. doi: 10.1016/j.ccell.2018.10.015. Epub 2018 Nov 29. To clone sgRNA for SaCas9 Lenti_SaCRISPR_GFP
    Nme2Cas9_pCDestNme2Cas9 (Other)CMV Sontheimer A Compact, High-Accuracy Cas9 with a Dinucleotide PAM for In Vivo Genome Editing. Mol Cell. 2018 Dec 18. pii: S1097-2765(18)31033-5. doi: 10.1016/j.molcel.2018.12.003. Nme2Cas9 CMV-driven mammalian expression plasmid pCDest
    Nme2Cas9_AAVNme2Cas9 (Other)U1a Sontheimer A Compact, High-Accuracy Cas9 with a Dinucleotide PAM for In Vivo Genome Editing. Mol Cell. 2018 Dec 18. pii: S1097-2765(18)31033-5. doi: 10.1016/j.molcel.2018.12.003. All-in-one AAV plasmid expressing Nme2Cas9 with sgRNA cassette AAV
    AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)N-terminal fragment of SpyCas9 (Other) Niopek Cell-specific CRISPR-Cas9 activation by microRNA-dependent expression of anti-CRISPR proteins. Nucleic Acids Res. 2019 Apr 15. pii: 5458120. doi: 10.1093/nar/gkz271. AAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffold pZac2.1
  • Tags / Fusion Proteins
    • SV40-NLS (N terminal on insert)
    • split-intein (C terminal on insert)
  • EF1a-Cas9-2XNES-2ERT2Cas9, NES and ERT2 (Synthetic)EF1αZeocin Wang HIT-Cas9: A CRISPR/Cas9 Genome-Editing Device under Tight and Effective Drug Control. Mol Ther Nucleic Acids. 2018 Dec 7;13:208-219. doi: 10.1016/j.omtn.2018.08.022. Epub 2018 Sep 1. Express Cas9, 2xNES and 2 tandem ERT2 in mammalian cells pRRL.sin-18.ppy.
    pAAV.pU1a-SpCas9SpCas9 (Synthetic)U1a Gao Cas9-mediated allelic exchange repairs compound heterozygous recessive mutations in mice. Nat Biotechnol. 2018 Oct;36(9):839-842. doi: 10.1038/nbt.4219. Epub 2018 Aug 13. Expresses codon-optimized SpCas9 in mammalian cells. pAAV
    pCF204Cas9 (Other)U6Puromycin Savage CRISPR-Cas9 Circular Permutants as Programmable Scaffolds for Genome Modification. Cell. 2019 Jan 10;176(1-2):254-267.e16. doi: 10.1016/j.cell.2018.11.052. U6-sgRNA EFS-Cas9-wt-P2A-Puro pU6
    pCF226cas9 (Other)EF-1a core promoterPuromycin Savage CRISPR-Cas9 Circular Permutants as Programmable Scaffolds for Genome Modification. Cell. 2019 Jan 10;176(1-2):254-267.e16. doi: 10.1016/j.cell.2018.11.052. EFS-Cas9-wt-P2A-Puro pEFS
    pLenti spCas9 T2A iRFP670 P2A purospCas9, iRFP670Puromycin Gaudin Lenti spCas9 T2A iRFP670 P2A puro (unpublished) The plasmid codes for a Flag-spCas9 protein, a iRFP670 fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences. pLenti NEWENTRY
    pLenti spCas9 T2A mNeonGreen P2A purospCas9, mNeonGreenPuromycin Gaudin Lenti spCas9 T2A iRFP670 P2A puro (unpublished) The plasmid codes for a Flag-spCas9 protein, a mNeonGreen fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences. pLenti NEWENTRY
    pLenti spCas9 T2A TagRFP-T P2A purospCas9, TagRFP-T Gaudin Lenti spCas9 T2A iRFP670 P2A puro (unpublished) The plasmid codes for a Flag-spCas9 protein, a TagRFP-T fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences. pLenti
    pSaCas9-1xms2-2x3’UTRSaCas9-MS2-HBB 3' UTR (Other) Lu Delivering SaCas9 mRNA by lentivirus-like bionanoparticles for transient expression and efficient genome editing. Nucleic Acids Res. 2019 Feb 13. pii: 5316732. doi: 10.1093/nar/gkz093. For expressing SaCas9 mRNA with one copy of MS2 aptamer and 2 copies of HBB 3' UTR pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
    pSaCas9-1xPP7-2x3'UTRSaCas9-PP7-HBB 3' UTR (Other) Lu Delivering SaCas9 mRNA by lentivirus-like bionanoparticles for transient expression and efficient genome editing. Nucleic Acids Res. 2019 Feb 13. pii: 5316732. doi: 10.1093/nar/gkz093. For expressing SaCas9 mRNA with one copy of PP7 aptamer and 2 copies of HBB 3' UTR pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
    PCS2+ Cas9Cas9 (Synthetic)SP6 Rossant Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. For in vitro transcription to produce Cas9 mRNA for microinjection into mouse embryos PCS2+
    pRC10-EFS-huLbCpf1-2A-Blast-WPREhuman codon-optimized Cpf1/Cas12a from Lachnospiraceae bacterium, (Synthetic)EFS-NSBlasticidin Chen In vivo profiling of metastatic double knockouts through CRISPR-Cpf1 screens. Nat Methods. 2019 May;16(5):405-408. doi: 10.1038/s41592-019-0371-5. Epub 2019 Apr 8. Lentiviral vector to constitutively express humanized LbCpf1/Cas12a, with blasticidin resistance for selection. pFUGW
    KA2058_pX330A-G2PPuromycin Schöler Esrrb Unlocks Silenced Enhancers for Reprogramming to Naive Pluripotency. Cell Stem Cell. 2018 Aug 2;23(2):266-275.e6. doi: 10.1016/j.stem.2018.05.020. Epub 2018 Jun 14. Expression of SpCas9 and sgRNA pX330
    KA2601_eSpCas9-G2PPuromycin Schöler Esrrb Unlocks Silenced Enhancers for Reprogramming to Naive Pluripotency. Cell Stem Cell. 2018 Aug 2;23(2):266-275.e6. doi: 10.1016/j.stem.2018.05.020. Epub 2018 Jun 14. Expression of eSpCas9(1.1) and sgRNA eSpCas9(1.1)
    KA2706_eSpCas9-PGKPacdtkChPuromycin Schöler Esrrb Unlocks Silenced Enhancers for Reprogramming to Naive Pluripotency. Cell Stem Cell. 2018 Aug 2;23(2):266-275.e6. doi: 10.1016/j.stem.2018.05.020. Epub 2018 Jun 14. Expression of eSpCas9(1.1) and sgRNA eSpCas9(1.1)
    KA2963_eSpCas9-PGKHygdtkChHygromycin Schöler Esrrb Unlocks Silenced Enhancers for Reprogramming to Naive Pluripotency. Cell Stem Cell. 2018 Aug 2;23(2):266-275.e6. doi: 10.1016/j.stem.2018.05.020. Epub 2018 Jun 14. Expression of eSpCas9(1.1) and sgRNA eSpCas9(1.1)
    pX330-NL-DHFR-SpCas9NL-DHFR-SpCas9 (Other)Cbh Choudhary A Singular System with Precise Dosing and Spatiotemporal Control of CRISPR-Cas9. Angew Chem Int Ed Engl. 2019 May 6;58(19):6285-6289. doi: 10.1002/anie.201900788. Epub 2019 Apr 2. Expresses SpCas9 fused to DHFR domains on both the N-terminus and an internal loop in mammalian cells pX330
    pX330-NLC-DHFR-SpCas9NLC-DHFR-SpCas9 (Other)Cbh Choudhary A Singular System with Precise Dosing and Spatiotemporal Control of CRISPR-Cas9. Angew Chem Int Ed Engl. 2019 May 6;58(19):6285-6289. doi: 10.1002/anie.201900788. Epub 2019 Apr 2. Expresses SpCas9 fused to DHFR domains on both the N- and C- termini and an internal loop in mammalian cells pX330
    Lenti-Cas9-gRNA-GFPGFP Sheltzer Generating Single Cell-Derived Knockout Clones in Mammalian Cells with CRISPR/Cas9. Curr Protoc Mol Biol. 2019 Sep;128(1):e100. doi: 10.1002/cpmb.100. 3rd generation lentiviral plasmid encoding Cas9, GFP, and a gRNA backbone LRG2.1 (Addgene #108098)
    Lenti-Cas9-gRNA-TagBFP2TagBFP2 Sheltzer Generating Single Cell-Derived Knockout Clones in Mammalian Cells with CRISPR/Cas9. Curr Protoc Mol Biol. 2019 Sep;128(1):e100. doi: 10.1002/cpmb.100. 3rd generation lentiviral plasmid encoding Cas9, TagBFP2, and a gRNA backbone Lenti-Cas9-gRNA-GFP (Addgene #124770)
    pAAV-FLEX-SaCas9-U6-sgRNAgRNA scaffold (Mus musculus) Zweifel Zweifel CRISPR plasmids (unpublished) Vector for Cre-dependent expression of SaCas9 pX601
    pMSCV-Cas9-2A-GFP-sgRNACas9 (Synthetic)MSCV Lodish Efficient CRISPR-Cas9 mediated gene disruption in primary erythroid progenitor cells. Haematologica. 2016 Jun;101(6):e216-9. doi: 10.3324/haematol.2015.135723. Epub 2016 Mar 11. Contains spCas9-2A-GFP and guide RNA scaffold in single retroviral vector pMCSV
    pAAVS1-tet-iCas9-BFP2AAVS1-TET-ON 3G-SpCas9-P2A-BFP2 (Homo sapiens)U6Neomycin (select with G418) Moffat Essential Gene Profiles for Human Pluripotent Stem Cells Identify Uncharacterized Genes and Substrate Dependencies. Cell Rep. 2019 Apr 9;27(2):599-615.e12. doi: 10.1016/j.celrep.2019.02.041. all-in-one-inducible Cas9 pAAVS1
    LentiV_Cas9_BlastCas9 (Synthetic)EFS promoter, EFS promoterBlasticidin Vakoc Salt-Inducible Kinase inhibition suppresses acute myeloid leukemia progression in vivo. Blood. 2019 Nov 1. pii: 422697. doi: 10.1182/blood.2019001576. Lentiviral expression of spCas9 with blasticidin resistance gene LentiV_Blast
    PB_tre_Cas9humanized S. pyrogenes Cas9, Hygromycin resistanceTRE, EF1 alphaHygromycin Calabrese A piggyBac-based toolkit for inducible genome editing in mammalian cells. RNA. 2019 May 17. pii: rna.068932.118. doi: 10.1261/rna.068932.118. PiggyBac cargo vector expressing doxycycline inducible Cas9 piggyBac cargo vector
    pcDNA-Cas9-T2A-STOP-TdTCas9-T2A-STOP-TdT (Homo sapiens)pCMVHygromycin Liu DNA writing at a single genomic site enables lineage tracing and analog recording in mammalian cells bioRxiv (2019) Expresses Cas9 but not TdT in mammalian cells; control for pcDNA-Cas9-T2A-TdT. (pTBL552) pcDNA3.1
    pX330-Flag-WT_SpCas9 (without sgRNA; with silent mutations)WT SpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-optimized WT SpCas9 (without U6-sgRNA coding sequence, with silent mutations) pX330-like (without U6-sgRNA coding sequence)
    pX330-Flag-eSpCas9 (without sgRNA; with silent mutations)eSpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-optimized increased fidelity eSpCas9 (without U6-sgRNA coding sequence, with silent mutations) pX330-like (without U6-sgRNA coding sequence)
    pX330-Flag-SpCas9-HF1 (without sgRNA; with silent mutations)SpCas9-HF1 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-optimized increased fidelity SpCas9-HF1 (without U6-sgRNA coding sequence, with silent mutations) pX330-like (without U6-sgRNA coding sequence)
    pX330-Flag-HypaSpCas9 (without sgRNA; with silent mutations)HypaSpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-optimized increased fidelity HypaSpCas9 (without U6-sgRNA coding sequence, with silent mutations) pX330-like (without U6-sgRNA coding sequence)
    pX330-Flag-evoSpCas9 (without sgRNA; with silent mutations)evoSpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-optimized increased fidelity evoSpCas9 (without U6-sgRNA coding sequence, with silent mutations) pX330-like (without U6-sgRNA coding sequence)
    pX330-Flag-HeFSpCas9 (without sgRNA; with silent mutations)HeFSpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence, with silent mutations) pX330-like (without U6-sgRNA coding sequence)
    B-SpCas9B-SpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-optimized Blackjack-SpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than that of WT SpCas9. pX330-like (without U6-sgRNA coding sequence)
    B-eSpCas9B-eSpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-optimized increased fidelity Blackjack-eSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than eSpCas9. pX330-like (without U6-sgRNA coding sequence)
    B-SpCas9-HF1B-SpCas9-HF1 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-opt. increased fidelity Blackjack-SpCas9-HF1 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than SpCas9HF1. pX330-like (without U6-sgRNA coding sequence)
    B-HypaSpCas9B-HypaSpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-opt. increased fidelity Blackjack-HypaSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HypaSpCas9. pX330-like (without U6-sgRNA coding sequence)
    B-evoSpCas9B-evoSpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-opt. increased fidelity Blackjack-evoSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than evoSpCas9. pX330-like (without U6-sgRNA coding sequence)
    B-HeFSpCas9B-HeFSpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-opt. increased fidelity Blackjack-HeFSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HeFSpCas9. pX330-like (without U6-sgRNA coding sequence)
    eSpCas9-pluseSpCas9-plus (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-optimized increased fidelity eSpCas9-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9. pX330-like (without U6-sgRNA coding sequence)
    SpCas9-HF1-plusSpCas9-HF1-plus (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-opt. increased fidelity SpCas9-HF1-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1 pX330-like (without U6-sgRNA coding sequence)
    pX330-Flag-Sniper SpCas9 (without sgRNA; with silent mutations)Sniper SpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-optimized increased fidelity Sniper SpCas9 (without U6-sgRNA coding sequence, with silent mutations) pX330-like (without U6-sgRNA coding sequence)
    pX330-Flag-HiFi SpCas9 (without sgRNA; with silent mutations)HiFi SpCas9 (Other)CBh Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression plasmid for human codon-optimized increased fidelity HiFi SpCas9 (without U6-sgRNA coding sequence, with silent mutations) pX330-like (without U6-sgRNA coding sequence)
    TLCV2-LoxPCas9-2A-eGFP (Homo sapiens)U6Puromycin Karpf Karpf Lab plasmids (unpublished) LentiCRISPR v2 was modified into an all-in-one dox inducible system. lentiCRISPR v2
    pFUGW Cas9-BFPCas9 (Other)SVVF Zhuang Imaging-based pooled CRISPR screening reveals regulators of lncRNA localization. Proc Natl Acad Sci U S A. 2019 May 28;116(22):10842-10851. doi: 10.1073/pnas.1903808116. Epub 2019 May 13. Cas9 expression pFUGW
    LentiAsCpf1-3xMYC-blastAsCpf1 (Synthetic)Blasticidin Draetta Pooled library screening with multiplexed Cpf1 library. Nat Commun. 2019 Jul 17;10(1):3144. doi: 10.1038/s41467-019-10963-x. Lentiviral plasmid for expressing human codon-optimized AsCpf1 containing 3x N-terminal MYC-NLS signal pFUGW
    pSpCas9(BB)-2A-NeoEmpty backboneNeomycin (select with G418) Takemaru Used for expression of sgRNA in mammalian cells (unpublished) Used for expression of sgRNA in mammalian cells pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene#62988)
    pSpCas9(BB)-2A-HygroHygromycin Takemaru Used for expression of sgRNA in mammalian cells (unpublished) Used for expression of sgRNA in mammalian cells pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene#62988)
    pX330GFP-hU6-gRNA-hSpCas9GFP, gRNA and hSpCas9 Tucker CRISPR-Cas9-Based Genome Editing of Human Induced Pluripotent Stem Cells. (unpublished) GFP positive gRNA/hSpCas9 construct pX330
    pCDNA3.3 CAS9 IRES-DsredFnCas9 IRES-Dsred (Synthetic) Laur Emory Custom Cloning Core Plasmids - Oskar Laur (unpublished) expression of FnCas9 and DsRed pCDNA3.3 CAS9
    p1195-pssAAV.U1a.hNme2Cas9codon-optimized Nme2Cas9 (Other)U1a Sontheimer Tissue-restricted Genome Editing in vivo Specified by MicroRNA-repressible Anti-CRISPR Proteins. RNA. 2019 Aug 22. pii: rna.071704.119. doi: 10.1261/rna.071704.119. AAV vector expressing Nme2Cas9 AAV
    pCas9/VRQR-sgRNA (BbsI)Puromycin ; mCherry for FACS enrichment Ikonen An efficient auxin-inducible degron system with low basal degradation in human cells. Nat Methods. 2019 Aug 26. pii: 10.1038/s41592-019-0512-x. doi: 10.1038/s41592-019-0512-x. Expressing SpCas9/VRQR mutant and sgRNA for target sequence with NGA PAM pGL3-basic
    PX458-3xHA-SpCas93xHA-NLS-SpCas9 (Synthetic)Cbh Chakraborty Francisella novicida Cas9 interrogates genomic DNA with very high specificity and can be used for mammalian genome editing. Proc Natl Acad Sci U S A. 2019 Oct 15;116(42):20959-20968. doi: 10.1073/pnas.1818461116. Epub 2019 Sep 30. 3xHA tagged Cas9 from S. pyogenes with T2A-EGFP and cloning backbone for sgRNA PX458
    PX458-3xHA-FnCas93xHA-NLS-FnCas9 (Synthetic)Cbh Chakraborty Francisella novicida Cas9 interrogates genomic DNA with very high specificity and can be used for mammalian genome editing. Proc Natl Acad Sci U S A. 2019 Oct 15;116(42):20959-20968. doi: 10.1073/pnas.1818461116. Epub 2019 Sep 30. 3xHA tagged Cas9 from F. novicida with T2A-EGFP and cloning backbone for sgRNA PX458
    pX458M-53BP1-DN1SSpCas9-53BP1-DN1S (Homo sapiens)CBH Malik CRISPR-Cas9 fusion to dominant-negative 53BP1 enhances HDR and inhibits NHEJ specifically at Cas9 target sites. Nat Commun. 2019 Jun 28;10(1):2866. doi: 10.1038/s41467-019-10735-7. Plasmid encoding Cas9-53BP1-DN1S fusion with BbsI restriction sites for insertion of guide RNA sequence. PX458M TP53BP1 53BP1, TDRD30, p202, p53BP1
    pSaCas9-sgRNA-Tetra-com vectorvector for com modified sgRNA (Synthetic) Lu Delivering Cas9/sgRNA ribonucleoprotein (RNP) by lentiviral capsid-based bionanoparticles for efficient 'hit-and-run' genome editing. Nucleic Acids Res. 2019 Jul 12. pii: 5531787. doi: 10.1093/nar/gkz605. For expressing gRNA, whose Tetraloop is replaced with a com aptamer pX601
    pCAG-T3-SpCAS9-NG-pACodon optimized SpCas9-NG (Synthetic) Fujii Generation of genetically modified mice using SpCas9-NG engineered nuclease. Sci Rep. 2019 Sep 9;9(1):12878. doi: 10.1038/s41598-019-49394-5. Expresses SpCAS9-NG nuclease in mammalian cells. Used to modify genome of mouse embroys pCAGGS
    pCAG-T3-eSpCAS9-NG-pACodon optimized eSpCas9-NG (Synthetic) Fujii Generation of genetically modified mice using SpCas9-NG engineered nuclease. Sci Rep. 2019 Sep 9;9(1):12878. doi: 10.1038/s41598-019-49394-5. Expresses eSpCAS9-NG nuclease in mammalian cells. Used to modify genome of mouse embroys pCAGGS
    pCAG-T3-HypaCAS9-pACodon optimized HypaCas9 (Synthetic) Fujii High-fidelity endonuclease variant HypaCas9 facilitates accurate allele-specific gene modification in mouse zygotes. Commun Biol. 2019 Oct 10;2:371. doi: 10.1038/s42003-019-0627-8. eCollection 2019. Expresses HypaCas9 nuclease in mammalian cells. Used to modify genome of mouse embroys pCAGGS
    pORANGE Cloning template vectorSpCas9 (Other)U6 and Cbh MacGillavry ORANGE: A CRISPR/Cas9-based genome editing toolbox for epitope tagging of endogenous proteins in neurons bioRxiv Cloning template form ORANGE method based knock-in constructs pORANGE
  • Tag / Fusion Protein
    • HA (N terminal on insert)
  • pFUGW SpCas9SpCas9 (Other)hUBC MacGillavry ORANGE: A CRISPR/Cas9-based genome editing toolbox for epitope tagging of endogenous proteins in neurons bioRxiv lentiviral expression of SpCas9 under hUBC promotor pFUGW
    pCAG-T3-st1CAS9-pACodon optimized st1Cas9 (Synthetic) Fujii Zygote-mediated generation of genome-modified mice using Streptococcus thermophilus 1-derived CRISPR/Cas system. Biochem Biophys Res Commun. 2016 Jun 16. pii: S0006-291X(16)30988-3. doi: 10.1016/j.bbrc.2016.06.070. Expresses S. thermophilus 1-derived Cas9 nuclease in mammalian cells. Used to modify genome of mouse embroys pCAG-T3-hCAS9-pA
    pCAG-T3-CjCAS9-pACodon optimized CjCas9 (Synthetic)CAG, T3 Fujii Efficient Generation of Genome-Modified Mice Using Campylobacter jejuni-Derived CRISPR/Cas. Int J Mol Sci. 2017 Oct 31;18(11). pii: ijms18112286. doi: 10.3390/ijms18112286. Expresses Campylobacter jejuni-derived Cas9 nuclease in mammalian cells. Used to modify genome of mouse embroys pCAG-T3-hCAS9-pA
    pAWp63-clone32 (Opti-SpCas9)Opti-SpCas9 (Synthetic)EFSZeocin Wong Combinatorial mutagenesis en masse optimizes the genome editing activities of SpCas9. Nat Methods. 2019 Aug;16(8):722-730. doi: 10.1038/s41592-019-0473-0. Epub 2019 Jul 15. Expresses Opti-SpCas9 in mammalian cells pFUGW
    pAWp63-clone3-12 (OptiHF-SpCas9)OptiHF-SpCas9 (Synthetic)EFSZeocin Wong Combinatorial mutagenesis en masse optimizes the genome editing activities of SpCas9. Nat Methods. 2019 Aug;16(8):722-730. doi: 10.1038/s41592-019-0473-0. Epub 2019 Jul 15. Expresses OptiHF-SpCas9 in mammalian cells pFUGW
    pTBL716 4xHRE-YB-TATA-Cas9-ODD-T2A-TdTCas9-ODD-T2A-TdT (Homo sapiens)4xHRE_YB TATABlasticidin Liu DNA writing at a single genomic site enables lineage tracing and analog recording in mammalian cells bioRxiv (2019) Expresses hypoxia-inducible Cas9 and TdT in mammalian cells. pcDNA3.1
    SiC-V1SpCas9 (Synthetic) Neelamegham Doxycycline-Dependent Self-Inactivation of CRISPR-Cas9 to Temporally Regulate On- and Off-Target Editing. Mol Ther. 2019 Sep 12. pii: S1525-0016(19)30409-5. doi: 10.1016/j.ymthe.2019.09.006. SiC-V1 vector with SpCas9 gene and dTomato reporter. sgRNA targeting a gene of interest can be cloned downstream of U6 promoter. LentiCRISPR v2
    BII-gR-PtW-eSpCas9eSpCas9 (Other)CMV enhancer and hEf1a (CpG free)Puromycin Madison Madison Lab - manuscript in preparation (unpublished) Piggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expression BII-gR-PtW-EspCas9
  • Tag / Fusion Protein
    • HA-tagged eSpCas9 (N terminal on insert)
  • BII-gR-BtW-eSpCas9eSpCas9 (Other)CMV enhancer and hEf1a (CpG free)Blasticidin Madison Madison Lab - manuscript in preparation (unpublished) Piggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expression BII-gR-BtW-EspCas9
  • Tag / Fusion Protein
    • Flag-tagged eSpCas9 (N terminal on insert)
  • BII-ChBtW-eSpCas9eSpCas9 (Other)CMV enhancer and hEf1a (CpG free)Blasticidin Madison Madison Lab - manuscript in preparation (unpublished) Piggybac vector for constitutive expression BII-ChBtW
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)
  • BII-ChPtW-eSpCas9eSpCas9 (Other)CMV enhancer and hEf1a (CpG free)Puromycin Madison Madison Lab - manuscript in preparation (unpublished) Piggybac vector for constitutive expression BII-ChPtW
  • Tag / Fusion Protein
    • HA (N terminal on insert)
  • pXPR_212control guidePuromycin Doench Genetic screens in isogenic mammalian cell lines without single cell cloning (unpublished) U6 promoter expresses customizable Spyo-guide; EFS promoter expresses SaurCas9 and 2A site provides puromycin resistance lentiCRISPRv2
    pXPR_124SpyoCas9 (Other) Doench Genetic screens in isogenic mammalian cell lines without single cell cloning (unpublished) EF1a promoter expresses SpyoCas9 and P2A provides EGFP pLV
    pCAG-hSt3Cas9-NLS(SV40)-3xFLAG (KAC426)human codon optimized St3Cas9 (Synthetic)CAG Kleinstiver Broad-spectrum anti-CRISPR proteins facilitate horizontal gene transfer. Nat Microbiol. 2020 Apr;5(4):620-629. doi: 10.1038/s41564-020-0692-2. Epub 2020 Mar 26. CAG promoter expression plasmid for human codon optimized St3Cas9 nuclease with C-terminal NLS (SV40) pCAG (Addgene #11179)
  • Tag / Fusion Protein
    • NLS(SV40)-3xFLAG (C terminal on backbone)
  • pCAG-hCjeCas9-NLS(SV40)-3xFLAG (KAC579)human codon optimized CjeCas9 (Synthetic)CAG Kleinstiver Broad-spectrum anti-CRISPR proteins facilitate horizontal gene transfer. Nat Microbiol. 2020 Apr;5(4):620-629. doi: 10.1038/s41564-020-0692-2. Epub 2020 Mar 26. CAG promoter expression plasmid for human codon optimized CjeCas9 nuclease with C-terminal NLS (SV40) pCAG (Addgene #11179)
  • Tag / Fusion Protein
    • NLS(SV40)-3xFLAG (C terminal on backbone)
  • pCAG-hNmeCas9-NLS(SV40)-3xFLAG (KAC409)human codon optimized NmeCas9 (Synthetic)CAG Kleinstiver Broad-spectrum anti-CRISPR proteins facilitate horizontal gene transfer. Nat Microbiol. 2020 Apr;5(4):620-629. doi: 10.1038/s41564-020-0692-2. Epub 2020 Mar 26. CAG promoter expression plasmid for human codon optimized NmeCas9 nuclease with C-terminal NLS (SV40) pCAG (Addgene #11179)
  • Tag / Fusion Protein
    • NLS(SV40)-3xFLAG (C terminal on backbone)
  • HP138-puroContains Cas9 (Other)Puromycin Cheeseman Cheeseman Lab Plasmids (unpublished) Cas9 in a transposon array under a Tet inducible promoter. For making inducible Cas9 cell lines. Puro selection. unknown
    HP138-neoContains Cas9 (Other)Neomycin (select with G418) Cheeseman Cheeseman Lab Plasmids (unpublished) Cas9 in a transposon array under a Tet inducible promoter. For making inducible Cas9 cell lines. Neo/G418 selection unknown
    pCAG-hNme2Cas9-NLS(SV40)-3xFLAG (KAC582)human codon optimized Nme2Cas9 (Synthetic)CAG Kleinstiver Broad-spectrum anti-CRISPR proteins facilitate horizontal gene transfer. Nat Microbiol. 2020 Apr;5(4):620-629. doi: 10.1038/s41564-020-0692-2. Epub 2020 Mar 26. CAG promoter expression plasmid for human codon optimized Nme2Cas9 nuclease with C-terminal NLS (SV40) and 3x FLAG tag pCAG (Addgene plasmid #11179)
  • Tag / Fusion Protein
    • NLS(SV40)-3xFLAG (C terminal on insert)
  • px458_Conc2U6GFP Stange Universal and Efficient Electroporation Protocol for Genetic Engineering of Gastrointestinal Organoid J. Vis. Exp. 2020, e60704 Empty concatemer vector in which 2 sgRNAs can be inserted; with Cas9 + GFP pSpCas9(BB)-2A-GFP (PX458)
    px458_Conc3U6GFP Stange Universal and Efficient Electroporation Protocol for Genetic Engineering of Gastrointestinal Organoid J. Vis. Exp. 2020, e60704 Empty concatemer vector in which 3 sgRNAs can be inserted; with Cas9 + GFP pSpCas9(BB)-2A-GFP (PX458)
    px459V2.0_Conc2U6Puromycin Stange Universal and Efficient Electroporation Protocol for Genetic Engineering of Gastrointestinal Organoid J. Vis. Exp. 2020, e60704 Empty concatemer vector in which 2 sgRNAs can be inserted; with Cas9 + Puro pSpCas9(BB)-2A-Puro (PX459) V2.0
    px459V2.0_Conc3U6Puromycin Stange Universal and Efficient Electroporation Protocol for Genetic Engineering of Gastrointestinal Organoid J. Vis. Exp. 2020, e60704 Empty concatemer vector in which 3 sgRNAs can be inserted; with Cas9 + Puro pSpCas9(BB)-2A-Puro (PX459) V2.0
    pCAG-CFP-SaCas9-HF (without sgRNA)Staphylococcus aureus Cas9 nucleases with high genome-wide specificity Zheng Rationally engineered Staphylococcus aureus Cas9 nucleases with high genome-wide specificity. Proc Natl Acad Sci U S A. 2019 Sep 30. pii: 1906843116. doi: 10.1073/pnas.1906843116. Human expression vector for SaCas9-HF variant. pCAG-CFP
    pL40C_PGKintron_Cas9_GreenCas9-P2A-mNeonGreen (Other)hPGK promoter with beta-globin intron Bornhauser The Leukemogenic TCF3-HLF Complex Rewires Enhancers Driving Cellular Identity and Self-Renewal Conferring EP300 Vulnerability. Cancer Cell. 2019 Dec 9;36(6):630-644.e9. doi: 10.1016/j.ccell.2019.10.004. Epub 2019 Nov 14. Lentiviral vector coding Cas9 and mNeonGreen L40C
    pU6-(BsaI)_CBh-Cas9humanized S. pyogenes Cas9 (Other)CBh Shaul Recruitment of DNA Repair MRN Complex by Intrinsically Disordered Protein Domain Fused to Cas9 Improves Efficiency of CRISPR-Mediated Genome Editing. Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584. Expression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 pX330
    pU6-(BsaI)_CBh-UN-Cas9humanized S. pyogenes Cas9 (Other)CBh Shaul Recruitment of DNA Repair MRN Complex by Intrinsically Disordered Protein Domain Fused to Cas9 Improves Efficiency of CRISPR-Mediated Genome Editing. Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584. Expression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9 pX330
    pU6-(BsaI)_CBh-Cas9-T2A-mCherryhumanized S. pyogenes Cas9 (Other)CBh Shaul Recruitment of DNA Repair MRN Complex by Intrinsically Disordered Protein Domain Fused to Cas9 Improves Efficiency of CRISPR-Mediated Genome Editing. Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584. Expression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 linked to mCherry via a T2A peptide pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene 64324), modification of pX330 (Addgene 42230)
    pU6-(BsaI)_CBh-UN-Cas9-T2A-mCherryhumanized S. pyogenes Cas9 (Other)CBh Shaul Recruitment of DNA Repair MRN Complex by Intrinsically Disordered Protein Domain Fused to Cas9 Improves Efficiency of CRISPR-Mediated Genome Editing. Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584. Expression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9, linked to mCherry via a T2A peptide pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene 64324), modification of pX330 (Addgene 42230)
    pU6-(BsaI)_CBh-UC-Cas9-T2A-mCherryhumanized S. pyogenes Cas9 (Other)CBh Shaul Recruitment of DNA Repair MRN Complex by Intrinsically Disordered Protein Domain Fused to Cas9 Improves Efficiency of CRISPR-Mediated Genome Editing. Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584. Expression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to C-terminus of Cas9, linked to mCherry via a T2A peptide pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene 64324), modification of pX330 (Addgene 42230)
    pAAV-CMV-SauriCas9 Wang Yongming Wang lab plasmids (unpublished) Expresses SauriCas9, and cloning backbone for sgRNA AAV2 ITR vector
    pAAV-CMV-SauriCas9-KKH-PuroPuromycin Wang Yongming Wang lab plasmids (unpublished) Expresses SauriCas9-KKH and puromycin resistance genes, and cloning backbone for sgRNA AAV2 ITR vector
    U6_sgRNA_CAG_hSt1Cas9_CNRZ1066St1Cas9 LMD-9:CNRZ_1066 Chimera (Homo sapiens), sgRNA for St1Cas9 (Homo sapiens)CAG, hU6 Doyon Versatile and robust genome editing with Streptococcus thermophilus CRISPR1-Cas9. Genome Res. 2020 Jan;30(1):107-117. doi: 10.1101/gr.255414.119. Epub 2020 Jan 3. A single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:CNRZ1066 chimera) and its U6-driven sgRNA. MSP1594_2x_NLS (Plasmid #110625)
    U6_sgRNA_CAG_hSt1Cas9_LMG18311St1Cas9 LMD9:LMG18311 chimera (Homo sapiens), sgRNA for St1Cas9 (Homo sapiens)CAG, hU6 Doyon Versatile and robust genome editing with Streptococcus thermophilus CRISPR1-Cas9. Genome Res. 2020 Jan;30(1):107-117. doi: 10.1101/gr.255414.119. Epub 2020 Jan 3. A single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:LMG18311 chimera) and its U6-driven sgRNA. MSP1594_2x_NLS (Plasmid #110625)
    U6_sgRNA_CAG_hSt1Cas9_TH1477St1Cas9 LMD-9:TH1477 Chimera (Homo sapiens), sgRNA for St1Cas9 (Homo sapiens)CAG, hU6 Doyon Versatile and robust genome editing with Streptococcus thermophilus CRISPR1-Cas9. Genome Res. 2020 Jan;30(1):107-117. doi: 10.1101/gr.255414.119. Epub 2020 Jan 3. A single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:TH1477 chimera) and its U6-driven sgRNA. MSP1594_2x_NLS (Plasmid #110625)
    U6_sgRNA_CAG_hSt1Cas9_MTH17CL396St1Cas9 LMD-9:MTH17CL396 Chimera (Homo sapiens), sgRNA for St1Cas9 (Homo sapiens)CAG, hU6 Doyon Versatile and robust genome editing with Streptococcus thermophilus CRISPR1-Cas9. Genome Res. 2020 Jan;30(1):107-117. doi: 10.1101/gr.255414.119. Epub 2020 Jan 3. A single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:MTH17CL396 chimera) and its U6-driven sgRNA. MSP1594_2x_NLS (Plasmid #110625)
    pCMV-Cas9-NRRHCas9-NRRH (Other)CMV Liu Continuous evolution of SpCas9 variants compatible with non-G PAMs. Nat Biotechnology Expresses Cas9-NRRH in mammalian cells pBR322 CMV
    pCMV-Cas9-NRTHCas9-NRTH (Other)CMV Liu Continuous evolution of SpCas9 variants compatible with non-G PAMs. Nat Biotechnology Expresses Cas9-NRTH in mammalian cells pBR322 CMV
    pCMV-Cas9-NRCHCas9-NRCH (Other)CMV Liu Continuous evolution of SpCas9 variants compatible with non-G PAMs. Nat Biotechnology Expresses Cas9-NRCH in mammalian cells pBR322 CMV
    pCF820_U6-sgRNA-EF1a-mCherry2_lentiSpyCas9 GFP sgRNAmCherry2 Doudna Potent CRISPR-Cas9 inhibitors from Staphylococcus genomes. Proc Natl Acad Sci U S A. 2020 Mar 10. pii: 1917668117. doi: 10.1073/pnas.1917668117. Lenti expression of mCherry2 with U6 promoter for SpyCas9 sgRNA targeting GFP pCF525
    pCF823_EFS-Cas9-PuroR_lentiSpyCas9Puromycin Doudna Potent CRISPR-Cas9 inhibitors from Staphylococcus genomes. Proc Natl Acad Sci U S A. 2020 Mar 10. pii: 1917668117. doi: 10.1073/pnas.1917668117. Lenti expression of SpyCas9 with Puro selection pCF525
    pCF824_U6-Sau-sgRNA-EF1a-mCherry2_lentiSauCas9 GFP sgRNAmCherry2 Doudna Potent CRISPR-Cas9 inhibitors from Staphylococcus genomes. Proc Natl Acad Sci U S A. 2020 Mar 10. pii: 1917668117. doi: 10.1073/pnas.1917668117. Lenti expression of mCherry2 with U6 promoter for SauCas9 sgRNA targeting GFP pCF525
    pHLS-EF1a-FRB-SpCas9-ASpCas9, human codon optimized (Other) Hotta Extracellular nanovesicles for packaging of CRISPR-Cas9 protein and sgRNA to induce therapeutic exon skipping. Nat Commun. 2020 Mar 13;11(1):1334. doi: 10.1038/s41467-020-14957-y. Expresses FRB fused SpCas9 for NanoMEDIC packaging. pHLS
    pCC_01 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9-NLS-2A-Puro-WPRESpCas9 (Other)Puromycin Sanjana High-Throughput Screens of PAM-Flexible Cas9 Variants for Gene Knockout and Transcriptional Modulation. Cell Rep. 2020 Mar 3;30(9):2859-2868.e5. doi: 10.1016/j.celrep.2020.02.010. Expresses human codon-optimized SpCas9 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette. lentiCRISPRv2
    pCC_02 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9NG-NLS-2A-Puro-WPRESpCas9-NG (Other)Puromycin Sanjana High-Throughput Screens of PAM-Flexible Cas9 Variants for Gene Knockout and Transcriptional Modulation. Cell Rep. 2020 Mar 3;30(9):2859-2868.e5. doi: 10.1016/j.celrep.2020.02.010. Expresses human codon-optimized Cas9-NG nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette. lentiCRISPRv2
    pCC_03 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9-NLS-2A-Puro-WPRExCas9 3.7 (Other)Puromycin Sanjana High-Throughput Screens of PAM-Flexible Cas9 Variants for Gene Knockout and Transcriptional Modulation. Cell Rep. 2020 Mar 3;30(9):2859-2868.e5. doi: 10.1016/j.celrep.2020.02.010. Expresses human codon-optimized xCas9 3.7 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette. lentiCRISPRv2
    pCC_04 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9NG-NLS-2A-Puro-WPRExCas9-NG (Other)Puromycin Sanjana High-Throughput Screens of PAM-Flexible Cas9 Variants for Gene Knockout and Transcriptional Modulation. Cell Rep. 2020 Mar 3;30(9):2859-2868.e5. doi: 10.1016/j.celrep.2020.02.010. Expresses human codon-optimized xCas9-NG nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette. lentiCRISPRv2
    pCMV-T7-SpCas9-P2A-EGFP (RTW3027)human codon optimized SpCas9 with BPNLS-3xFLAG-P2A-EGFP (Synthetic)CMV and T7 Kleinstiver Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants Science , 26 Mar 2020 CMV and T7 promoter expression plasmid for human codon optimized SpCas9 with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFP JDS246
  • Tag / Fusion Protein
    • BPNLS-3xFLAG-P2A-EGFP (C terminal on insert)
  • pCMV-T7-SpG-P2A-EGFP (RTW4177)human codon optimized SpCas9 variant named SpG with BPNLS-3xFLAG-P2A-EGFP (Synthetic)CMV and T7 Kleinstiver Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants Science , 26 Mar 2020 CMV and T7 promoter expression plasmid for human codon optimized SpG(D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFP RTW3027
  • Tag / Fusion Protein
    • BPNLS-3xFLAG-P2A-EGFP (C terminal on insert)
  • pCMV-T7-SpRY-P2A-EGFP (RTW4830)human codon optimized SpCas9 variant named SpRY with BPNLS-3xFLAG-P2A-EGFP (Synthetic)CMV and T7 Kleinstiver Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants Science , 26 Mar 2020 CMV and T7 promoter expression plasmid for human codon optimized SpRY(A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFP RTW3027
  • Tag / Fusion Protein
    • BPNLS-3xFLAG-P2A-EGFP (C terminal on insert)
  • pCMV-T7-SpCas9-VQR-P2A-EGFP (RTW3520)human codon optimized SpCas9-VQR with BPNLS-3xFLAG-P2A-EGFP (Synthetic)CMV and T7 Kleinstiver Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants Science , 26 Mar 2020 CMV and T7 promoter expression plasmid for human codon optimized SpCas9-VQR(D1135V/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFP RTW3027
  • Tag / Fusion Protein
    • BPNLS-3xFLAG-P2A-EGFP (C terminal on insert)
  • pCMV-T7-SpCas9-VRER-P2A-EGFP (RTW3160)human codon optimized SpCas9-VRER with BPNLS-3xFLAG-P2A-EGFP (Synthetic)CMV and T7 Kleinstiver Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants Science , 26 Mar 2020 CMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRER(D1135V/G1218R/R1335E/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFP RTW3027
  • Tag / Fusion Protein
    • BPNLS-3xFLAG-P2A-EGFP (C terminal on insert)
  • pCMV-T7-SpCas9-VRQR-P2A-EGFP (RTW3161)human codon optimized SpCas9-VRQR with BPNLS-3xFLAG-P2A-EGFP (Synthetic)CMV and T7 Kleinstiver Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants Science , 26 Mar 2020 CMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRQR(D1135V/G1218R/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFP RTW3027
  • Tag / Fusion Protein
    • BPNLS-3xFLAG-P2A-EGFP (C terminal on insert)
  • pCMV-T7-xCas9(3.7)-P2A-EGFP (RTW3576)human codon optimized xCas9(3.7) with BPNLS-3xFLAG-P2A-EGFP (Synthetic)CMV and T7 Kleinstiver Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants Science , 26 Mar 2020 CMV and T7 promoter expression plasmid for human codon optimized xCas9(3.7)(A262T/R324L/S409I/E480K/E543D/M694I/E1219V) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFP RTW3027
  • Tag / Fusion Protein
    • BPNLS-3xFLAG-P2A-EGFP (C terminal on insert)
  • pCMV-T7-SpCas9-NG-P2A-EGFP (RTW3677)human codon optimized SpCas9-NG with BPNLS-3xFLAG-P2A-EGFP (Synthetic)CMV and T7 Kleinstiver Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants Science , 26 Mar 2020 CMV and T7 promoter expression plasmid for human codon optimized SpCas9-NG(L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFP RTW3027
  • Tag / Fusion Protein
    • BPNLS-3xFLAG-P2A-EGFP (C terminal on insert)
  • pCMV-T7-SpCas9-HF1-P2A-EGFP (RTW3505)human codon optimized SpCas9-HF1 with BPNLS-3xFLAG-P2A-EGFP (Synthetic)CMV and T7 Kleinstiver Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants Science , 26 Mar 2020 CMV and T7 promoter expression plasmid for human codon optimized SpCas9-HF1(N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFP RTW3027
  • Tag / Fusion Protein
    • BPNLS-3xFLAG-P2A-EGFP (C terminal on insert)
  • pCMV-T7-SpG-HF1-P2A-EGFP (RTW5000)human codon optimized SpCas9 variant named SpG-HF1 with BPNLS-3xFLAG-P2A-EGFP (Synthetic)CMV and T7 Kleinstiver Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants Science , 26 Mar 2020 CMV and T7 promoter expression plasmid for human codon optimized SpG-HF1(SpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R;HF1=N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFP RTW3027
  • Tag / Fusion Protein
    • BPNLS-3xFLAG-P2A-EGFP (C terminal on insert)
  • pCMV-T7-SpRY-HF1-P2A-EGFP (RTW5008)human codon optimized SpCas9 variant named SpRY-HF1 with BPNLS-3xFLAG-P2A-EGFP (Synthetic)CMV and T7 Kleinstiver Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants Science , 26 Mar 2020 CMV and T7 promoter expression plasmid for human codon optimized SpRY-HF1(SpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R;HF1=N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFP RTW3027
  • Tag / Fusion Protein
    • BPNLS-3xFLAG-P2A-EGFP (C terminal on insert)
  • pLentiCrispr-V2-mOrange (V2mO)pELF1aPuromycin ; mOrange flurescent marker Ajani An improved strategy for CRISPR/Cas9 gene knockout and subsequent wildtype and mutant gene rescue. PLoS One. 2020 Feb 13;15(2):e0228910. doi: 10.1371/journal.pone.0228910. eCollection 2020. Lenti Crispr/Cas9 with mOrange fluorescent marker pLentiCrispr-V2-mOrange (V2mO)


    Plasmid Gene/Insert Promoter PI Publication Hidden Extra Search Info
    pMJ806Cas9T7 Doudna A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science. 2012 Jun 28. pEC-K-MBP
    pCas9tracr/Cas9 Marraffini RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2508. Bacterial expression of Cas9 nuclease, tracrRNA and crRNA guide pACYC184
    pwtCas9-bacteriawild-type Cas9pLtetO-1 Qi Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell. 2013 Feb 28;152(5):1173-83. doi: 10.1016/j.cell.2013.02.022. aTc-inducible expression of wild-type Cas9 (S .pyogenes) for bacterial gene knockdown pUC19
    pET-28b-Cas9-HisCas9 (Other) Schier Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One. 2014 May 29;9(5):e98186. doi: 10.1371/journal.pone.0098186. eCollection 2014. For in vitro expression and purification of Cas9 protein pET-28b
    DS-SPcasCas9 (Other), tracrRNA precursor (Other)proC, tracrRNA promoter Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial S. pyogenes Cas9 (SP) + tracrRNA expression, cloDF13/spectinomycin cloDF13-aadA
    DS-NMcasCas9 (Other), NM tracrRNA (Other)proC, NM tracrRNA promoter Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial N. meningitidis Cas9 (NM) + tracrRNA expression, cloDF13/spectinomycin cloDF13-aadA
    DS-ST1casCas9 (Other), ST1 tracrRNA (Other)proC Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycin cloDF13-aadA
    pET28a/Cas9-CysCas9-Cys (Other)T7 Promoter Kim Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA. Genome Res. 2014 Apr 2. Expresses N-terminal His tag fused human codon-optimized Cas9 nuclease having C-terminal Cysteine pET28a
    pCRISPomyces-1sSpCas9 (Synthetic), tracrRNA (Other), crRNA cassette (Synthetic)rpsLp(XC)-BbsI, rpsLp(CF), gapdhp(EL) Zhao High-Efficiency Multiplex Genome Editing of Streptomyces Species Using an Engineered CRISPR/Cas System. ACS Synth Biol. 2014 Dec 8. Streptomyces expression of codon-optimized Cas9, tracrRNA, and custom crRNA pKC1139
    pCRISPomyces-2sSpCas9 (Synthetic), gRNA cassette (Synthetic)rpsL(XC)-BbsI, gapdhp(EL) Zhao High-Efficiency Multiplex Genome Editing of Streptomyces Species Using an Engineered CRISPR/Cas System. ACS Synth Biol. 2014 Dec 8. Streptomyces expression of codon-optimized Cas9 and custom gRNA pKC1139
    pCascas9 (Other)native cas9 promoter Yang Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14. Constitutive expression of cas9 and inducible expression of lambda RED and sgR pKD46
    pET-(-30)dGFP-9xGGS-Cath-NLS-Cas9-6xHis(-30)dGFP-9xGGS-Cath-NLS-Cas9-6xHis (Other)T7 Liu Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2015 Jan;33(1):73-80. doi: 10.1038/nbt.3081. Epub 2014 Oct 30. Expression of (-30)dGFP-9xGGS-Cath-NLS-Cas9-6xHis in bacterial cells pET29
    pET-Cas9-6xHisCas9_6xHis (Other)T7 Liu Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2015 Jan;33(1):73-80. doi: 10.1038/nbt.3081. Epub 2014 Oct 30. Expression of Cas9-6xHis in bacterial cells pET29
    pTrex-b-NLS-hSpCas9NLS-hSpCas9Ribo-HX1 Tarleton CRISPR-Cas9-Mediated Single-Gene and Gene Family Disruption in Trypanosoma cruzi. MBio. 2014 Dec 30;6(1). pii: e02097-14. doi: 10.1128/mBio.02097-14. Expression of Cas9 in T. cruzi pTrex-b
    pKCcas9dOScocas9 (Other), sgRNA (), act-orf4 homology armptipA, j23119 Jiang One-step high-efficiency CRISPR/Cas9-mediated genome editing in Streptomyces. Acta Biochim Biophys Sin (Shanghai). 2015 Apr;47(4):231-43. doi: 10.1093/abbs/gmv007. Epub 2015 Mar 3. High efficiency Streptomyces genome editing by CRISPR/Cas9 system pKC1139
    pCas9-CR4Cas9 nuclease Prather The no-SCAR (Scarless Cas9 Assisted Recombineering) system for genome editing in Escherichia coli. Sci Rep. 2015 Oct 14;5:15096. doi: 10.1038/srep15096. Cas9 nuclease under control of pTet promoter with ssrA tag and constitutive tetR pdCas9-bacteria
    SP-Cas9SP-CAS9 (Other)T7 Geijsen Efficient Intracellular Delivery of Native Proteins. Cell. 2015 Apr 23;161(3):674-690. doi: 10.1016/j.cell.2015.03.028. Expresses SP-Cas9 protein in bacterial cells pET-15
    pCMKCas9 (Synthetic) Rodrigue Bacterial constitutive gRNA expression plasmid (unpublished) Bacterial constitutive S. pyogenes Cas9 expression plasmid pCMK
    pET-Cas9-NLS-6xHisCas9-NLS-6xHis (Other)T7 Liu Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2015 Jan;33(1):73-80. doi: 10.1038/nbt.3081. Epub 2014 Oct 30. Expression of Cas9-NLS-6xHis in bacterial cells pET29
    pET-NLS-Cas9-6xHisNLS-Cas9-6xHis (Other)T7 Liu Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2015 Jan;33(1):73-80. doi: 10.1038/nbt.3081. Epub 2014 Oct 30. Expression of NLS-Cas9-6xHis in bacterial cells pET29
    pLPhygCAS9Humanized Streptococcus pyogenes Cas9 from PX330 (Addgene) (Other) Matlashewski CRISPR-Cas9-Mediated Genome Editing in Leishmania donovani. MBio. 2015 Jul 21;6(4). pii: e00861-15. doi: 10.1128/mBio.00861-15. Expresses CAS9 in Leishmania pLPHyg2
    pYTK036Cas9 (Other) Dueber A Highly-characterized Yeast Toolkit for Modular, Multi-part Assembly. ACS Synth Biol. 2015 Apr 14. Encodes Cas9 as a Type 3 part to be used in the Dueber YTK system pYTK001
    BPK764mammalian codon-optimized Streptococcus pyogenes Cas9-NLS-3XFlag, and SpCas9 gRNA (Other)T7 (x2) Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Bacterial expression plasmid for SpCas9 & sgRNA (need to clone spacer into BsaI sites): T7-humanSpCas9-NLS-3xFLAG-T7-BsaIcassette-Sp-sgRNA pACYCDuet-1
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • MSP1673mammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS, and St1Cas9 gRNA (Other)T7 (x2) Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Bacterial expression plasmid for S. thermophilus1 Cas9 & sgRNA (need to clone in spacer into BspMI sites): T7-humanSt1Cas9-NLS-T7-BspMIcassette-St1-sgRNA pACYCDuet-1
  • Tag / Fusion Protein
    • NLS (C terminal on insert)
  • BPK2101mammalian codon-optimized Staphylococcus aureus Cas9-NLS-3xFlag, and SaCas9 gRNA (Other)T7 (x2) Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Bacterial expression plasmid for S. aureus Cas9 & sgRNA (need to clone in spacer into BsaI sites): T7-humanSaCas9-NLS-3xFLAG-T7-BsaIcassette-Sa-sgRNA pACYCDuet-1
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • pHO4d-Cas9Cas9 (Other)T7 Nonet Landscape of target:guide homology effects on Cas9-mediated cleavage. Nucleic Acids Res. 2014 Dec 16;42(22):13778-87. doi: 10.1093/nar/gku1102. Epub 2014 Nov 15. Cas9nlsHis6 Bacterial Expression construct pHO4D
    pMJ915cas9 (Other)T7 Doudna Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery. Elife. 2014 Dec 15;3:e04766. doi: 10.7554/eLife.04766. Express Streptococcus pyogenes Cas9 carrying two C-terminal SV40 NLS pML-2CT
    MSP2283mammalian codon-optimized Staphylococcus aureus Cas9-NLS-3xFlag (Other), SaCas9 sgRNA (+84)T7, T7 Joung Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. 2015 Nov 2. doi: 10.1038/nbt.3404. Bacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1 pACYCDuet-1
    MSP2253mammalian codon-optimized KKH variant Staphylococcus aureus Cas9(E782K/N968K/R1015H)-NLS-3xFlag (Other), SaCas9 sgRNA (+84)T7, T7 Joung Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. 2015 Nov 2. doi: 10.1038/nbt.3404. Bacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #1 pACYCDuet-1
    MSP2266mammalian codon-optimized Staphylococcus aureus Cas9-NLS-3xFlag (Other), SaCas9 sgRNA (+84)T7, T7 Joung Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. 2015 Nov 2. doi: 10.1038/nbt.3404. Bacterial expression plasmid for SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2 pACYCDuet-1
    MSP2292mammalian codon-optimized KKH variant Staphylococcus aureus Cas9(E782K/N968K/R1015H)-NLS-3xFlag, and SaCas9 sgRNA(84) (Other), SaCas9 sgRNA (+84)T7, T7 Joung Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. 2015 Nov 2. doi: 10.1038/nbt.3404. Bacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #2 pACYCDuet-1
    pCas9_sgRNA_0U6 promoter (Other), cas9 (Synthetic), tnos terminator (Other)U6 from Ustilago maydis, synthetic otef promoter (Spellig et al., 1996, Mol. Gen. Genet. 252) Kahmann Genome editing in Ustilago maydis using the CRISPR-Cas system. Fungal Genet Biol. 2015 Sep 11. pii: S1087-1845(15)30025-6. doi: 10.1016/j.fgb.2015.09.001. expresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicating pNEBUC
    pMCSG7-Wt-NmeCas9pMCSG7-WT-NmeCas9 (Other) Sontheimer DNase H Activity of Neisseria meningitidis Cas9. Mol Cell. 2015 Oct 15;60(2):242-55. doi: 10.1016/j.molcel.2015.09.020. bacterial pMCSG7 expression vector expressing Wildtype Nme cas9 with T7 promoter, N-terminal His tag and TEV site pMCSG7
    pCas9curCas9 (Other), Plasmid curing systempBAD Chen Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metab Eng. 2015 Sep;31:13-21. doi: 10.1016/j.ymben.2015.06.006. Epub 2015 Jun 30. Constitutive expression of Cas9 gene and inducible expression of the plasmid curing system for CRISPR mediated genome editing of E. coli. pSC101ts
    pREDCas9Cas9 (Other), lambda red genes, plasmid curing systempBAD Chen Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metab Eng. 2015 Sep;31:13-21. doi: 10.1016/j.ymben.2015.06.006. Epub 2015 Jun 30. Constitutive expression of Cas9, inducible expression of the Red recombineering system, and inducible expression of the plasmid curing system for CRISPR mediated genome editing of E. coli. pSC101ts
    pCAS1ylCas9 (Other), sgRNA (Synthetic)unknown Yang Multiplex gene editing of the Yarrowia lipolytica genome using the CRISPR-Cas9 system. J Ind Microbiol Biotechnol. 2016 Aug;43(8):1085-93. doi: 10.1007/s10295-016-1789-8. Epub 2016 Jun 27. Constitutive expression of Cas9 and sgRNA in Yarrowia lipolytica cells pMCSCen1
    pMA7CR_2.0cas9 (Other), lambda beta (Other), dam (Other), recX (Other)pTet, pAra, pAra, pTet Nielsen CRMAGE: CRISPR Optimized MAGE Recombineering. Sci Rep. 2016 Jan 22;6:19452. doi: 10.1038/srep19452. pMA7CR_2.0 contains arabinose inducible λ/RED β-protein and dam, and aTc inducible CRISPR/Cas9 and recX pBAD24
    pDEST-hisMBP-AsCpf1-ECAsCpf1 (Synthetic)tac promoter Kim Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nat Biotechnol. 2016 Jun 6. doi: 10.1038/nbt.3596. Expressing his-MBP tagged AsCpf1 (E.coli codon optimized) pDEST-hisMBP
    pMAL-his-LbCpf1-ECLbCpf1 (Synthetic)tac promoter Kim Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nat Biotechnol. 2016 Jun 6. doi: 10.1038/nbt.3609. Bacterial expression - MBP-his tagged LbCpf1 (E.coli codon optimized) pMAL-c5X
    pCas9-CATCas9 (Other), Chloramphenicol acetyltransferaseTgTUB1, TgTUB1 Lourido A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2. Encodes Cas9 and chloramphenicol acetyltransferase (CAT) pU6-Universal
    pU6-DecoyDecoy sgRNAU6 Lourido A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2. Encodes Cas9 and a CRISPR sgRNA that alleviates toxicity to Cas9 in Toxoplasma gondii pU6-Universal
    bbCas9pluspAAACas9 (Other)T7 Huijbers Direct Generation of Conditional Alleles Using CRISPR/Cas9 in Mouse Zygotes. Methods Mol Biol. 2017;1642:21-35. doi: 10.1007/978-1-4939-7169-5_2. The plasmid encodes the T7 promoter, Cas9 (from pX330 #42230) and a stretch of poly-A. After linearization with restriction enzyme SapI It is used to produce in vitro transcribed mRNA pUC
    pEC-K-CBP_CjeCas9CjeCas9 (Other) Doudna Single-Stranded DNA Cleavage by Divergent CRISPR-Cas9 Enzymes. Mol Cell. 2015 Nov 5;60(3):398-407. doi: 10.1016/j.molcel.2015.10.030. Expresses Campylobacter jejuni Cas9 (Cje Cas9). pEC-K
    p2CT-CdiCdiCas9 Doudna Single-Stranded DNA Cleavage by Divergent CRISPR-Cas9 Enzymes. Mol Cell. 2015 Nov 5;60(3):398-407. doi: 10.1016/j.molcel.2015.10.030. Expresses Corynebacterium diphtheriae Cas9 (CdiCas9) PET
    pLdCNgRNA and Cas9 (Other)L. donovani ribosome RNA promoter Matlashewski Optimized CRISPR-Cas9 Genome Editing for Leishmania and Its Use To Target a Multigene Family, Induce Chromosomal Translocation, and Study DNA Break Repair Mechanisms. mSphere. 2017 Jan 18;2(1). pii: e00340-16. doi: 10.1128/mSphere.00340-16. eCollection 2017 Jan-Feb. Express gRNA and Cas9 in Leishmania with Neomycin resistance pSP72
    pLdCHgRNA and Cas9 (Other)L. donovani ribosome RNA promoter Matlashewski Optimized CRISPR-Cas9 Genome Editing for Leishmania and Its Use To Target a Multigene Family, Induce Chromosomal Translocation, and Study DNA Break Repair Mechanisms. mSphere. 2017 Jan 18;2(1). pii: e00340-16. doi: 10.1128/mSphere.00340-16. eCollection 2017 Jan-Feb. Express gRNA and Cas9 in Leishmania with Hygromycin resistance pSP72
    pJYS3_ΔcrtYfCpf1 (Other), crRNA of crtYf (Synthetic) Yang CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179. Constitutive transcription of FnCpf1 and crRNA of crtYf pXMJ19
    pJYS1PtacCpf1 (Other), recT (Other)tac, unknown Yang CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179. Constitutive trancription of FnCpf1 and recT in C.glutamitum, tac promoter pXMJ19
    pJYS1PeftuCpf1 (Other), recT (Other)etfu, unknown Yang CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179. Constitutive expression of FnCpf1 and recT in C.glutamitum, etfu promoter pXMJ19
    pX2-Cas9Cas9 (Other)pBAD Gill pX2-Cas9 (unpublished) Arabinose inducible Cas9 in a broad host range backbone. pBTBX-2
    pSHS212Cas9 (Other)T7 Doudna Conformational control of DNA target cleavage by CRISPR-Cas9. Nature. 2015 Nov 5;527(7576):110-3. doi: 10.1038/nature15544. Epub 2015 Oct 28. Cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid pCT10
    pSHS293Cas9 (Other)T7 Doudna Conformational control of DNA target cleavage by CRISPR-Cas9. Nature. 2015 Nov 5;527(7576):110-3. doi: 10.1038/nature15544. Epub 2015 Oct 28. D435C/E945C in cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid, lobe closure FRET construct pCT10
    pSHS306 - Bacterial expression plasmid for SpCas9, HNH FRET variantCas9 (Other)T7 Doudna Conformational control of DNA target cleavage by CRISPR-Cas9. Nature. 2015 Nov 5;527(7576):110-3. doi: 10.1038/nature15544. Epub 2015 Oct 28. S867C/S355C in cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid, HNH-1 FRET construct pCT10
    pSHS248Cas9 (Other)T7 Doudna Conformational control of DNA target cleavage by CRISPR-Cas9. Nature. 2015 Nov 5;527(7576):110-3. doi: 10.1038/nature15544. Epub 2015 Oct 28. S867C/N1054C in cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid, HNH-2 FRET construct pCT10
    pET-MBP-Geo_stGeoCas9 (Other) Doudna GeoCas9 Plasmids (unpublished) Expression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP pET
    pET-MBP-NLS-Geo_stGeoCas9 (Other) Doudna GeoCas9 Plasmids (unpublished) Expression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP and SV40 NLS pET
    pFC330Cas9 (Synthetic), pyrG (Other)Aspergillus nidulans tef1 promoter, native promoter Mortensen A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. PLoS One. 2015 Jul 15;10(7):e0133085. doi: 10.1371/journal.pone.0133085. eCollection 2015. AMA1 plasmid with Aspergillus optimized Cas9 and pyrG selection marker custom
    pFC331Cas9 (Synthetic), argB (Other)Aspergillus nidulans tef1 promoter, native promoter Mortensen A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. PLoS One. 2015 Jul 15;10(7):e0133085. doi: 10.1371/journal.pone.0133085. eCollection 2015. AMA1 plasmid with Aspergillus optimized Cas9 and argB selection marker custom
    pFC333Cas9 (Synthetic), ble (bleomycin resistance marker) (Other)Aspergillus nidulans tef1 promoter, Aspergillus nidulans trpC promoter Mortensen A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. PLoS One. 2015 Jul 15;10(7):e0133085. doi: 10.1371/journal.pone.0133085. eCollection 2015. AMA1 plasmid with Aspergillus optimized Cas9 and ble selection marker custom
    pFC332Cas9 (Synthetic), hph (hygromycin resistance marker) (Other)Aspergillus nidulans tef1 promoter, Aspergillus nidulans trpC promoter Mortensen A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. PLoS One. 2015 Jul 15;10(7):e0133085. doi: 10.1371/journal.pone.0133085. eCollection 2015. AMA1 plasmid with Aspergillus optimized Cas9 and hph selection marker custom
    pMJ915v2+Nterm Spe1 +Cterm Age1 site Doudna Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806. For expression of modified SpyCas9 in e.coli. pMJ915
    1xNLS-pMJ915v2Cas9 Doudna Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806. For expression of modified SpyCas9 in e.coli. pMJ915
    2xNLS-pMJ915v2Cas9, T7 Doudna Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806. For expression of modified SpyCas9 in e.coli. pMJ915
    4xNLS-pMJ915v2Cas9, T7 Doudna Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806. For expression of modified SpyCas9 in e.coli. pMJ915
    pMJ915v2 + sfGFPCas9, T7 Doudna Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806. For expression of modified SpyCas9 in e.coli. pMJ915
    1xNLS-pMJ915v2-sfGFPCas9, T7 Doudna Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806. For expression of modified SpyCas9 in e.coli. pMJ915
    2xNLS-pMJ915v2-sfGFPCas9, T7 Doudna Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806. For expression of modified SpyCas9 in e.coli. pMJ915
    4xNLS-pMJ915v2-sfGFPCas9, T7 Doudna Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806. For expression of modified SpyCas9 in e.coli. pMJ915
    7xNLS-pMJ915v2-sfGFPCas9, T7 Doudna Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806. For expression of modified SpyCas9 in e.coli. pMJ915
    pET-CjCas9CjCas9 (Other)T7 Kim In vivo genome editing with a small Cas9 orthologue derived from Campylobacter jejuni. Nat Commun. 2017 Feb 21;8:14500. doi: 10.1038/ncomms14500. Expression of CjCas9 with His tag in E.coli pET28b
    pEM-Cas9HF1Cas9HF1 (Other)pTet Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174. Modified from pCas9-CR4 (Addgene: 62655) to use the high-fidelity version of Cas9, SpCas9-HF1 (N497A/R661A/Q695A/Q926A) from Kleinstiver et al 2016. pCas9-CR4
    pEM-Cas9HF1-recA56Cas9HF1 (Other), recA56 (Other)pTet, proD Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174. Modified from pEM-Cas9HF1 (Addgene ID: 89961) to include constitutive recA56 to block recA-mediated double-strand break repair. pEM-Cas9HF1
    6-His-MBP-TEV-FnCpf1FnCpf1 (humanized) (Other)T7 Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Bacterial expression plasmid for protein purification pET-28
    6His-MBP-TEV-huAsCpf1huAsCpf1 (Other) Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Bacterial expression plasmid for protein purification pET-28
    6His-MBP-TEV-huLbCpf1huLbCpf1 (Other) Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Bacterial expression plasmid for protein purification pET-28
    pMST665_BB3_L 23_gRNAempty_cas9_BbsICas9 Sauer An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30643-0. doi: 10.1016/j.biortech.2017.05.004. BB3_L 23_gRNAempty_cas9_BbsI; CRISPR plasmid with empty gRNA spacer to incorporate gRNA, Cas9 BB3_AMA_2.8_pUC-ORI_L_AC_hph
    pFREECas9, gRNA array (Synthetic)ptet, pRhamBAD Norholm A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z. Allows inducible expression of gRNAs and Cas9 for plasmid curing. pMAZ-SK
    pFREE_AmpCas9, gRNA array (Synthetic)ptet, pRhamBAD Norholm A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z. Allows inducible expression of gRNAs and Cas9 for plasmid curing. pMAZ-SK
    pFREE_CmCas9, gRNA array (Synthetic)ptet, pRhamBAD Norholm A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z. Allows inducible expression of gRNAs and Cas9 for plasmid curing. pMAZ-SK
    pFREE_ZeoCas9, gRNA array (Synthetic)ptet, pRhamBAD Norholm A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z. Allows inducible expression of gRNAs and Cas9 for plasmid curing. pMAZ-SK
    pFREE-RK2Cas9, gRNA array (Synthetic)ptet, pRhamBAD Norholm A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z. Allows inducible expression of gRNAs and Cas9 for plasmid curing as well as self-curing via a temperature sensitive RK2 replicon. pMAZ-SK
    pLQ-Pxyl/tet-cas9-Pj23119-sgRNACas9-Pxyltet-sgRNA-pj23119 (Other) Yang CRISPR/Cas9-based efficient genome editing in Staphylococcus aureus. Acta Biochim Biophys Sin (Shanghai). 2017 Sep 1;49(9):764-770. doi: 10.1093/abbs/gmx074. CRISPR-Cas9 based efficient genome editing in S. aureus unknown
    pET28a-Cas9-HisNLS-Cas9-NLS (Other)T7 Gao Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nat Commun. 2017 Jan 18;8:14261. doi: 10.1038/ncomms14261. Purification of Cas9 protein pET28a (+)
    p46Cpf1-OP2FnCpf1 (Other)araBAD Wu Qiong Wu CRISPR plasmids (unpublished) Produces lambda Red and Cpf1 for recombination and selection. The plasmid is combined with a donor plasmid (with crRNA and template) for rapid genome editing in E.coli. pKD46
    pJWV102-wtcas9spcas9sp (Synthetic)PczcD Kjos Chromosome segregation drives division site selection in Streptococcus pneumoniae. Proc Natl Acad Sci U S A. 2017 Jul 3. pii: 201620608. doi: 10.1073/pnas.1620608114. Plasmid containing wild-type cas9sp pJWV102
    pThermoCas9_ctrlCas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain (Other), ThermoCas9 single guide RNA expressing module (Other)B. smithii xylL promoter, B. coagulans DSM 1 pta promoter van der Oost Characterizing a thermostable Cas9 for bacterial genome editing and silencing. Nat Commun. 2017 Nov 21;8(1):1647. doi: 10.1038/s41467-017-01591-4. Expresses ThermoCas9 and its sgRNA module pNW33n
    SpyCas9(WT)SpyCas9 (Synthetic) Huang Structural basis of CRISPR-SpyCas9 inhibition by an anti-CRISPR protein. Nature. 2017 Jun 15;546(7658):436-439. doi: 10.1038/nature22377. Epub 2017 Apr 27. Express Streptococcus pyogenes Cas9 pGEX-6P-1
  • Tag / Fusion Protein
    • GST (N terminal on backbone)
  • p6XHis_NLS-SaCas9CRISPR-associated protein Cas9/Csn1 [Staphylococcus aureus subsp. aureus] (Other)T7lac Tarleton Rapid, Selection-Free, High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins. MBio. 2017 Nov 7;8(6). pii: e01788-17. doi: 10.1128/mBio.01788-17. Express SaCas9 in bacteria with a 6xHis tag for purification pET-32 EK/LIC
    pSHS207 - Bacterial expression plasmid for WT SpCas9SpCas9 (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for WT SpCas9 pCT10
    pJSC033 - Bacterial expression plasmid for SpCas9, REC2 FRET variantSpCas9 variant C80S/C574S/E60C/D273C (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9, REC2 FRET variant pCT10
    pJSC052 - Bacterial expression plasmid for SpCas9, REC3 FRET variantSpCas9 variant C80S/C574S/S701C/S960C (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9, REC3 FRET variant pCT10
    pSHS273 - Bacterial expression plasmid for SpCas9∆REC3 variantSpCas9 variant M1–N497,GGS,V713–D1368 (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9∆REC3 variant pCT10
    pJSC038 - Bacterial expression plasmid for SpCas9∆REC3, HNH FRET variantSpCas9 variant C80S/C574S/S355C/S867C/M1–N497,GGS,V713–D1368 (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9∆REC3, HNH FRET variant pCT10
    pJSC057 - Bacterial expression plasmid for SpCas9∆REC3, REC2 FRET variantSpCas9 variant C80S/C574S/E60C/D273C/M1–N497,GGS,V713–D1368 (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9∆REC3, REC2 FRET variant pCT10
    pSHS325 - Bacterial expression plasmid for SpCas9 REC3 domainSpCas9 variant K506–Q712 (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 REC3 domain pCT10
    pJSC176 - Bacterial expression plasmid for SpCas9 + Q926A variantSpCas9 variant Q926A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 + Q926A variant pCT10
    pJSC119 - Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A variantSpCas9 variant N497A/R661A/Q695A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A variant pCT10
    pJSC120 - Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variantSpCas9 variant C80S/C574S/S355C/S867C/N497A/R661A/Q695A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variant pCT10
    pJSC111 - Bacterial expression plasmid for SpCas9-HF1 variantSpCas9 variant N497A/R661A/Q695A/Q926A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9-HF1 variant pCT10
    pJSC115 - Bacterial expression plasmid for SpCas9-HF1, HNH FRET variantSpCas9 variant C80S/C574S/S355C/S867C/N497A/R661A/Q695A/Q926A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9-HF1, HNH FRET variant pCT10
    pJSC129 - Bacterial expression plasmid for SpCas9-HF1, REC2 FRET variantSpCas9 variant C80S/C574S/E60C/D273C/N497A/R661A/Q695A/Q926A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9-HF1, REC2 FRET variant pCT10
    pJSC131 - Bacterial expression plasmid for SpCas9-HF1, REC3 FRET variantSpCas9 variant C80S/C574S/S701C/S960C/N497A/R661A/Q695A/Q926A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9-HF1, REC3 FRET variant pCT10
    pJSC090 - Bacterial expression plasmid for SpCas9 + K855A variantSpCas9 variant K855A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 + K855A variant pCT10
    pJSC077 - Bacterial expression plasmid for SpCas9 + K855A, HNH FRET variantSpCas9 variant C80S/C574S/S355C/S867C/K855A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 + K855A, HNH FRET variant pCT10
    pJSC114 - Bacterial expression plasmid for SpCas9 eSpCas9(1.1) variantSpCas9 variant K848A/K1003A/R1060A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 eSpCas9(1.1) variant pCT10
    pJSC270 - Bacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variantSpCas9 variant K848A/K1003A/R1060A/N497A/R661A/Q695A/Q926A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant pCT10
    pJSC173 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9) variantSpCas9 variant N692A/M694A/Q695A/H698A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9) variant pCT10
    pJSC269 - Bacterial expression plasmid for SpCas9 Cluster 1 + Q926A variantSpCas9 variant N692A/M694A/Q695A/H698A/Q926A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 Cluster 1 + Q926A variant pCT10
    pJSC011 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variantSpCas9 variant C80S/C574S/S355C/S867C/N692A/M694A/Q695A/H698A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variant pCT10
    pJSC281 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC2 FRET variantSpCas9 variant C80S/C574S/E60C/D273C/N692A/M694A/Q695A/H698A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC2 FRET variant pCT10
    pJSC282 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variantSpCas9 variant C80S/C574S/S701C/S960C/N692A/M694A/Q695A/H698A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variant pCT10
    pJSC197 - Bacterial expression plasmid for SpCas9 Cluster 2 + Q926A variantSpCas9 variant G528A/V583A/E584A/D585A/N588A/Q926A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 Cluster 2 + Q926A variant pCT10
    pJSC228 - Bacterial expression plasmid for SpCas9 Cluster 2 variantSpCas9 variant G582A/V583A/E584A/D585A/N588A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 Cluster 2 variant pCT10
    pJSC239 - Bacterial expression plasmid for SpCas9 Cluster 3 + Q926A variantSpCas9 variant T657A/G658A/W659A/R661A/Q926A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 Cluster 3 + Q926A variant pCT10
    pJSC236 - Bacterial expression plasmid for SpCas9 Cluster 4 + Q926A variantSpCas9 variant F491A/M495A/T496A/N497A/Q926A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 Cluster 4 + Q926A variant pCT10
    pJSC272 - Bacterial expression plasmid for SpCas9 Cluster 5 + Q926A variantSpCas9 variant K918A/V922A/R925A/Q926A (Other)T7 Doudna Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Bacterial expression plasmid for SpCas9 Cluster 5 + Q926A variant pCT10
    pEM-Cas9HF1-indRecA56Cas9HF1 (Other), recA56pTet, pTet Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174. Modified from pEM-Cas9HF1 (Addgene ID: 89961) to co-express inducible recA56 to block recA-mediated double-strand break repair. pEM-Cas9HF1
    AsCpf1-2NLSAsCpf1-6xHis-MBP-TEV (Synthetic)T7 Doudna CRISPR-Cpf1 mediates efficient homology-directed repair and temperature-controlled genome editing. Nat Commun. 2017 Dec 8;8(1):2024. doi: 10.1038/s41467-017-01836-2. bacterial expression of AsCpf1-2NLS pET
    LbCpf1-2NLSLbCpf1 (Synthetic)T7 Doudna CRISPR-Cpf1 mediates efficient homology-directed repair and temperature-controlled genome editing. Nat Commun. 2017 Dec 8;8(1):2024. doi: 10.1038/s41467-017-01836-2. bacterial expression of LbCpf1-2NLS pET
    pSBY1_FnCpf1cgFnCpf1 (Other)hsp60 Yang A CRISPR-Cpf1-Assisted Non-Homologous End Joining Genome Editing System of Mycobacterium smegmatis. Biotechnol J. 2018 Sep;13(9):e1700588. doi: 10.1002/biot.201700588. Epub 2018 Aug 6. CRISPR system used to genome editing in Mycobacterium smegmatis, expresses Fn CPf1 pMV261
    pJK02Upstream & Downstream pyrE deletion region (Other), tetR, Cas9 (Other), gRNA Sorg Using CRISPR-Cas9-mediated genome editing to generate C. difficile mutants defective in selenoproteins synthesis. Sci Rep. 2017 Nov 7;7(1):14672. doi: 10.1038/s41598-017-15236-5. Clostridium difficile CRISPR-cas9 mutagenesis plasmid traJ oriT pMTL84151
    pKM126Upstream & Downstream pyrE deletion region (Other), tetR, Cas9 (Other), gRNA Sorg Using CRISPR-Cas9-mediated genome editing to generate C. difficile mutants defective in selenoproteins synthesis. Sci Rep. 2017 Nov 7;7(1):14672. doi: 10.1038/s41598-017-15236-5. Clostridium difficile CRISPR-cas9 mutagenesis plasmid Tn916 oriT pJS116
    pCas9cas9 (Other), Lambda red genes (Other)J23105, araBAD Pfleger Genetic tools for reliable gene expression and recombineering in Pseudomonas putida. J Ind Microbiol Biotechnol. 2018 Jan 3. pii: 10.1007/s10295-017-2001-5. doi: 10.1007/s10295-017-2001-5. Recombineering plasmid with constitutively expressed cas9 and the araBAD promoter expressing αβγ pSEVA224
    p2T-CAG-KKHSaCas9-BlastRKKH SaCas9Chicken ß-Actin Sherwood Predictable and precise template-free CRISPR editing of pathogenic variants. Nature. 2018 Nov;563(7733):646-651. doi: 10.1038/s41586-018-0686-x. Epub 2018 Nov 7. Confers constitutive expression of KKH SaCas9. p2T-CAG-MCS-BlastR NEWENTRY
    pCAS9counterCas9, sgRNAprab17, prab17 Salipante Efficient and Scalable Precision Genome Editing in Staphylococcus aureus through Conditional Recombineering and CRISPR/Cas9-Mediated Counterselection. MBio. 2018 Feb 20;9(1). pii: mBio.00067-18. doi: 10.1128/mBio.00067-18. Expresses CAS9 and sgRNA for targeted counterselection in S. aureus pCN-50
    pxCas9CR4TetR and xCas9 (Synthetic) Reisch pCas9CR4 with point mutations from Cas9X for NG PAM sites (unpublished) PCas9CR4 with the xCas9 mutations allowing NG PAM sites p15A origin
    pRPaCas9Cas9 (Other) Horn Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes. Sci Rep. 2018 May 21;8(1):7960. doi: 10.1038/s41598-018-26303-w. Expresses Cas9 in T. brucei (2T1) cells pUC
    pCas9-J23109Cas9 (Other) Zhang Improved sgRNA design in bacteria via genome-wide activity profiling. Nucleic Acids Res. 2018 Aug 21;46(14):7052-7069. doi: 10.1093/nar/gky572. Plasmid constitutively expressing Cas9 protein N.A.
    peSpCas9-J23109eSpCas9 (Other) Zhang Improved sgRNA design in bacteria via genome-wide activity profiling. Nucleic Acids Res. 2018 Aug 21;46(14):7052-7069. doi: 10.1093/nar/gky572. Plasmid constitutively expressing eSpCas9 protein N.A.
    pCasPA Ji CRISPR/Cas9-based Genome Editing in Pseudomonas aeruginosa and Cytidine Deaminase-Mediated Base Editing in Pseudomonas Species. iScience. 2018 Aug 31;6:222-231. doi: 10.1016/j.isci.2018.07.024. Epub 2018 Aug 1. Bacterial expression of Cas9 nuclease and λ-Red system in Pseudomonas aeruginosa unknown
    pNS20-SpCas9-SNAPCas9 (Other) Schwank Covalent linkage of the DNA repair template to the CRISPR-Cas9 nuclease enhances homology-directed repair. Elife. 2018 May 29;7. pii: 33761. doi: 10.7554/eLife.33761. Bacterial vector for expression of Snap-tagged Streptococcus pyogenes Cas9 pET His6 MBP N10 TEV LIC cloning vector (2C-T)
    pET-21a_3xNLS_SpCas9_protein_expression3xNLS_SpCas9 (Synthetic)T7 Wolfe Highly efficient therapeutic gene editing of human hematopoietic stem cells. Nat Med. 2019 May;25(5):776-783. doi: 10.1038/s41591-019-0401-y. Epub 2019 Mar 25. Protein expression plasmid for 3xNLS SpCas9 in pET-21a backbone pET-21 a
    pET-21a_2xNLS_LbCpf1_protein_expression2xNLS_LbCpf1 (Synthetic)T7 Wolfe Editing aberrant splice sites efficiently restores beta-globin expression in beta-thalassemia. Blood. 2019 Jan 31. pii: blood-2019-01-895094. doi: 10.1182/blood-2019-01-895094. Protein expression plasmid for 2xNLS LbCpf1 in pET-21a backbone pET-21 a
    pJL1-SpCas9S. pyogenes Cas9 (Other)T7 Jewett BioBits Health: Classroom Activities Exploring Engineering, Biology, and Human Health with Fluorescent Readouts. ACS Synth Biol. 2019 May 7. doi: 10.1021/acssynbio.8b00381. In vitro expression of S. pyogenes Cas9 from the T7 promoter pJL1
    pCasKP-aprCas9 (Other) Ji Precise and efficient genome editing in Klebsiella pneumoniae using CRISPR-Cas9 and CRISPR-assisted cytidine deaminase. Appl Environ Microbiol. 2018 Sep 14. pii: AEM.01834-18. doi: 10.1128/AEM.01834-18. Bacterial expression of Cas9 nuclease and lambda-Red system in Klebsiella Pneumoniae Unknown
    pCasKP-hphCas9 (Other) Ji Precise and efficient genome editing in Klebsiella pneumoniae using CRISPR-Cas9 and CRISPR-assisted cytidine deaminase. Appl Environ Microbiol. 2018 Sep 14. pii: AEM.01834-18. doi: 10.1128/AEM.01834-18. Bacterial expression of Cas9 nuclease and lambda-Red system in Klebsiella Pneumoniae Unknown
    pHSB04XCas9, promotor PslpA-guide-RNA, homologous arms of Lb_1019 (Other) Yang Development of a RecE/T-Assisted CRISPR-Cas9 Toolbox for Lactobacillus. Biotechnol J. 2019 Jul;14(7):e1800690. doi: 10.1002/biot.201800690. Epub 2019 May 20. Genome editing for Lactobacillus brevis ATCC367 pCas
    pHSP02Cas9, promotor P11-guide-RNA, homologous arms of Lp_0537 (Other) Yang Development of a RecE/T-Assisted CRISPR-Cas9 Toolbox for Lactobacillus. Biotechnol J. 2019 Jul;14(7):e1800690. doi: 10.1002/biot.201800690. Epub 2019 May 20. Genome editing for Lactobacillus plantarum WCSF1 pCas
    p15A_SpyCas9_CmRCas9 from S. pyogenes Noireaux An educational module to explore CRISPR technologies with a cell-free transcription-translation system (unpublished) Expresses S. pyogenes Cas9 p15A, Chloramphenicol resistance NEWENTRY
    pCas9-J23113Cas9 (Other) Zhang Improved sgRNA design in bacteria via genome-wide activity profiling. Nucleic Acids Res. 2018 Aug 21;46(14):7052-7069. doi: 10.1093/nar/gky572. Expression of Cas9 with a weak promoter p15A origin
    Nme2Cas9_pMCSG7Nme2Cas9 (Other)T7 Sontheimer A Compact, High-Accuracy Cas9 with a Dinucleotide PAM for In Vivo Genome Editing. Mol Cell. 2018 Dec 18. pii: S1097-2765(18)31033-5. doi: 10.1016/j.molcel.2018.12.003. Nme2Cas9 bacterial expression plasmid pMCSG7
    NmeCas9_3XNLS_pMCSG7NmeCas9 (Other) Sontheimer NmeCas9 is an intrinsically high-fidelity genome editing platform (unpublished) Bacterial expression of wtNmeCas9 with 3X NLS pMCSG7
    pCas9CR4-VQRSpCas9-VQR (Synthetic)pTet Reisch pCas9CR4 variants for increased targeting space (unpublished) pCas9CR4 with VQR mutations for changing PAM site specificity to NGAN or NGNG from Kleinstiver et al. 2015 pdCas9-bacteria
    pCas9CR4-NGSpCas9-NG (Synthetic)pTet Reisch pCas9CR4 variants for increased targeting space (unpublished) pCas9CR4 with mutations to change PAM site specificity to NG from Nishimasu et al. pdCas9-bacteria
    pCas9CR5SpCas9 (Synthetic)pTet Reisch pCas9CR4 variants for increased targeting space (unpublished) pCas9CR4 with stop codon to prevent translation of ssrA degradation tag pdCas9-bacteria
    pCas9CR5-NGSpCas9-NG (Synthetic)pTet Reisch pCas9CR4 variants for increased targeting space (unpublished) pCas9CR5 with mutations to change PAM site specificity to NG from Nishimasu et al. pdCas9-bacteria
    pJZ002 Moore Refactoring the Cryptic Streptophenazine Biosynthetic Gene Cluster Unites Phenazine, Polyketide, and Nonribosomal Peptide Biochemistry. Cell Chem Biol. 2019 Feb 15. pii: S2451-9456(19)30038-8. doi: 10.1016/j.chembiol.2019.02.004. CRISPR-cas9 targeting in E. coli with ampicillin resistance N/A
    pSU-araC-Cas9Cas9 (Other)araBAD Yang Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14. Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system p15A
    pET-21a_2xNLS_FnCpf1_MBP_protein_expression2xNLS_FnCpf1 (Synthetic)T7 Wolfe Enhanced Cas12a editing in mammalian cells and zebrafish. Nucleic Acids Res. 2019 Mar 20. pii: 5403491. doi: 10.1093/nar/gkz184. Protein expression plasmid for 2xNLS FnCpf1 in pET-21a backbone pET-21 a
    pUC-fFuCas9-HTBNLS-hphCas9 and hygromycin resist gene (Other)gpdA;trpC Ji CRISPR/Cas9-Based Genome Editing in the Filamentous Fungus Fusarium fujikuroi and Its Application in Strain Engineering for Gibberellic Acid Production. ACS Synth Biol. 2019 Feb 15;8(2):445-454. doi: 10.1021/acssynbio.8b00478. Epub 2019 Jan 23. Multigene editing in the Fusarium fujikuroi genome using the CRISPR-Cas9 system pUC57
    pEJS1026-pMCSG7-HpaCas9HpaCas9 (Other) Sontheimer Potent Cas9 Inhibition in Bacterial and Human Cells by AcrIIC4 and AcrIIC5 Anti-CRISPR Proteins. MBio. 2018 Dec 4;9(6). pii: mBio.02321-18. doi: 10.1128/mBio.02321-18. Expresses a 6X-His tagged type II-C Cas9 from H. parainfluenzae in bacterial cells pMCSG7
    pEJS1027-pMCSG7-SmuCas9SmuCas9 (Other) Sontheimer Potent Cas9 Inhibition in Bacterial and Human Cells by AcrIIC4 and AcrIIC5 Anti-CRISPR Proteins. MBio. 2018 Dec 4;9(6). pii: mBio.02321-18. doi: 10.1128/mBio.02321-18. Expresses a 6X-His tagged type II-C Cas9 from S. muelleri in bacterial cells pMCSG7
    pCasAb-apr Ji A Highly Efficient CRISPR-Cas9-Based Genome Engineering Platform in Acinetobacter baumannii to Understand the H2O2-Sensing Mechanism of OxyR. Cell Chem Biol. 2019 Sep 17. pii: S2451-9456(19)30277-6. doi: 10.1016/j.chembiol.2019.09.003. Bacterial expression of Cas9 nuclease and RecAb recombination system in Acinetobacter baumannii pMMB67EH
    pCpf1 Zhang Expanding the potential of CRISPR-Cpf1 based genome editing technology in the cyanobacterium Anabaena PCC 7120. ACS Synth Biol. 2018 Dec 10. doi: 10.1021/acssynbio.8b00437. Bacterial genome editing plasmid with kanamycin resistance marker Unknown
    pCpf1-sp Zhang Expanding the potential of CRISPR-Cpf1 based genome editing technology in the cyanobacterium Anabaena PCC 7120. ACS Synth Biol. 2018 Dec 10. doi: 10.1021/acssynbio.8b00437. Bacterial genome editing plasmid with spectinomycin resistance marker Unknown
    pCpf1b Zhang Expanding the potential of CRISPR-Cpf1 based genome editing technology in the cyanobacterium Anabaena PCC 7120. ACS Synth Biol. 2018 Dec 10. doi: 10.1021/acssynbio.8b00437. Bacterial genome editing plasmid with kanamycin resistance marker and using sacB as a counter-selection marker Unknown
    pCpf1b-sp Zhang Expanding the potential of CRISPR-Cpf1 based genome editing technology in the cyanobacterium Anabaena PCC 7120. ACS Synth Biol. 2018 Dec 10. doi: 10.1021/acssynbio.8b00437. Bacterial genome editing plasmid with spectinomycin resistance marker and using sacB as a counter-selection marker Unknown
    pLdSaCNgRNA and SaCas9 (Other) Matlashewski Single-Strand Annealing Plays a Major Role in Double-Strand DNA Break Repair following CRISPR-Cas9 Cleavage in Leishmania. mSphere. 2019 Aug 21;4(4). pii: 4/4/e00408-19. doi: 10.1128/mSphere.00408-19. Expresses Staphylococcus aureus Cas9 (SaCas9) and its gRNA in Leishmania pSP72
    pLPhygSaCas9Staphylococcus aureus Cas9 (Other) Matlashewski Single-Strand Annealing Plays a Major Role in Double-Strand DNA Break Repair following CRISPR-Cas9 Cleavage in Leishmania. mSphere. 2019 Aug 21;4(4). pii: 4/4/e00408-19. doi: 10.1128/mSphere.00408-19. Expresses Staphylococcus aureus Cas9 (SaCas9) in Leishmania pSP72 NEWENTRY
    PCV-Cas9PCV2 (Other), Cas9 (Other) Gordon Increasing Cas9-mediated homology-directed repair efficiency through covalent tethering of DNA repair template. Commun Biol. 2018 May 31;1:54. doi: 10.1038/s42003-018-0054-2. eCollection 2018. Expresses Cas9 with an N-terminal HUH-tag called PCV2 pTD68 ORF1 PCV2_gp1
    Cas9-PCVPCV2 (Other), Cas9 (Other) Gordon Increasing Cas9-mediated homology-directed repair efficiency through covalent tethering of DNA repair template. Commun Biol. 2018 May 31;1:54. doi: 10.1038/s42003-018-0054-2. eCollection 2018. Expresses Cas9 with a C-terminal HUH-tag called PCV2 in E. coli pTD68 ORF1 PCV2_gp1
    spCas9-NLS-MAVcas9 (Other)T7 Akavia Double-Stranded Biotinylated Donor Enhances Homology-Directed Repair in Combination with Cas9 Monoavidin in Mammalian Cells. CRISPR J. 2018 Dec;1:414-430. doi: 10.1089/crispr.2018.0045. SpCas9-NLS 17 amino acid linker to monoavidin (SpCas9-NLS-MAV) pEC-K-MBP
    pET-21a_FnCpf1_2xNLS_protein_expressionFnCpf1_2xNLS (Synthetic) Wolfe Enhanced Cas12a editing in mammalian cells and zebrafish. Nucleic Acids Res. 2019 Mar 20. pii: 5403491. doi: 10.1093/nar/gkz184. Protein expression plasmid for 2xNLS FnCpf1 in pET-21a backbone pET-21 a
    pFD115Ptet (Other), cas9 (Other), term PpflB sgRNA (BsaI) (Synthetic)Ptet Bikard Gene silencing with CRISPRi in bacteria and optimization of dCas9 expression levels. Methods. 2019 Aug 1. pii: S1046-2023(18)30497-3. doi: 10.1016/j.ymeth.2019.07.024. pFD115 carries cas9 controlled by an aTc-inducible Ptet promoter, a sgRNA controlled constitutively from PpflB S. aureus promoter to clone a guide between two BsaI sites and oriT on pLZ12 vector pLZ12
    pCold CL7-Cas9 Cas9 (Other) Liu Co-expression of Cas9 and single-guided RNAs in Escherichia coli streamlines production of Cas9 ribonucleoproteins. Commun Biol. 2019 May 3;2:161. doi: 10.1038/s42003-019-0402-x. eCollection 2019. obtaining full Cas9 RNP pCold I
    pLdCN2gRNA and Cas9 (Other) Matlashewski Application of CRISPR/Cas9-Mediated Genome Editing in Leishmania. Methods Mol Biol. 2020;2116:199-224. doi: 10.1007/978-1-0716-0294-2_14. Expresses Streptococcus pyogenes Cas9 (SpCas9) and two gRNAs in Leishmania pLdCN
    pLQ-KO-tgt50Cas9-Pxyltet-sgRNA-Pspac-donor-tgt50 (Other) Yang CRISPR/Cas9-based efficient genome editing in Staphylococcus aureus. Acta Biochim Biophys Sin (Shanghai). 2017 Sep 1;49(9):764-770. doi: 10.1093/abbs/gmx074. CRISPR-Cas9 based efficient genome editing in S. aureus ColE1 origin, AmpR, Rep(+), cat resistance
    pET-FLAG-eSpCas9eSpCas9 (Other)T7 Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression of increased fidelity eSpCas9 in bacterial cells pMJ806-like
    pET-FLAG-SpCas9-HF1SpCas9-HF1 (Other)T7 Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression of increased fidelity SpCas9-HF1 in bacterial cells pMJ806-like
    pET-FLAG-B-eSpCas9B-eSpCas9 (Other)T7 Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression of increased fidelity Blackjack-eSpCas9 in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than that of eSpCas9 pMJ806-like
    pET-FLAG-eSpCas9-pluseSpCas9-plus (Other)T7 Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression of increased fidelity eSpCas9-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9. pMJ806-like
    pET-FLAG-SpCas9-HF1-plusSpCas9-HF1-plus (Other)T7 Welker Blackjack mutations improve the on-target activities of all increased fidelity variants of SpCas9 without compromising their fidelities Nature Communications, 1223, 2020 Expression of increased fidelity SpCas9-HF1-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1. pMJ806-like
    pIgnaviCas9IgnaviCas9 (Other)T7 promoter Quake Nucleic acid cleavage with a hyperthermophilic Cas9 from an uncultured Ignavibacterium. Proc Natl Acad Sci U S A. 2019 Oct 28. pii: 1904273116. doi: 10.1073/pnas.1904273116. Expresses IgnaviCas9 in E. coli pMJ806
    pCAH01Sp::Cas9Sp Cas9 (Other)Ptet Henard Development of a CRISPR/Cas9 System for Methylococcus capsulatus In Vivo Gene Editing. Appl Environ Microbiol. 2019 May 16;85(11). pii: AEM.00340-19. doi: 10.1128/AEM.00340-19. Print 2019 Jun 1. Ptet-controlled expression of S. pyogenes Cas9 pCAH01SpR
    pCasTet-λTetR and pTetR/TetO (Other)tet promoter Johnston Systematic evasion of the restriction-modification barrier in bacteria. Proc Natl Acad Sci U S A. 2019 May 16. pii: 1820256116. doi: 10.1073/pnas.1820256116. Constitutive expression of cas9 and anhydrotetracycline/tetracycline inducible expression of lamda RED. Useful variant of Plasmid #62225 when arabinose induction is not possible. Plasmid #62225
    pSDMA65Hygromycin (HYG) (Synthetic)ACT1 Fraser Targeted Genome Editing via CRISPR in the Pathogen Cryptococcus neoformans. (unpublished) Codon optimised Streptococcus pyogenes CAS9 ORF regulated by the Cryptococcus neoformans TEF1 promoter and terminator. pBlueScript II SK(-)
    pCRISPomyces-Sth1Cas9Sth1Cas9 (Other)rpsL(XC)-BbsI Wong Characterization of Cas proteins for CRISPR-Cas editing in streptomycetes. Biotechnol Bioeng. 2019 May 15. doi: 10.1002/bit.27021. Contains codon-optimized Sth1Cas9 and gRNA for streptomyces pKC1139
    pCRISPomyces-SaCas9SaCas9 (Other)rpsL(XC)-BbsI Wong Characterization of Cas proteins for CRISPR-Cas editing in streptomycetes. Biotechnol Bioeng. 2019 May 15. doi: 10.1002/bit.27021. Contains codon-optimized SaCas9 and gRNA for streptomyces pKC1139
    pCRISPomyces-FnCpf1FnCpf1 (Other)rpsL(XC)-BbsI Wong Characterization of Cas proteins for CRISPR-Cas editing in streptomycetes. Biotechnol Bioeng. 2019 May 15. doi: 10.1002/bit.27021. Contains codon-optimized FnCpf1 and gRNA for streptomyces pKC1139
    pET-His6-FnCas9GFPHA-NLS-FnCas9 (Synthetic)T7 Chakraborty Francisella novicida Cas9 interrogates genomic DNA with very high specificity and can be used for mammalian genome editing. Proc Natl Acad Sci U S A. 2019 Oct 15;116(42):20959-20968. doi: 10.1073/pnas.1818461116. Epub 2019 Sep 30. expression of FnCas9-GFP in bacterial cells pET-His6-GFP-TEV-LIC
    pKM197Upstream & Downstream pyrE deletion region (Other) Sorg Modified / Updated Clostridium difficile CRISPR-Cas9 genome editing plasmids (unpublished) pyrE-targeted CRISPR-Cas9 control plasmid. Cas9 expression is controlled by the xylR promoter and results in improved conjugation efficiency. Induction with xylose results in a pyrE mutant. pJS116
    pSCBE3-HFHF-BE3 (Other) Sun Base editing in Streptomyces with Cas9-deaminase fusions BioRxiv 630137 Expresses HF-BE3 CRISPR base editor and gRNA scaffold in Streptomyces pYH7


    Plasmid Gene/Insert Promoter Selectable Marker PI Publication Hidden Extra Search Info
    pHsp70-Cas9Codon optimized Cas9 O'Connor-Giles Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics. 2013 May 24. The codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter used in Gratz, et al. (2013). Plasmid is low copy number. pHSS6
    pBS-Hsp70-Cas9codon optimized Cas9Hsp70 O'Connor-Giles FlyCRISPR (unpublished) A codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter. pBluescript-KS(+)
    pAc-sgRNA-Cas9Cas9 (Synthetic), dU6-sgRNA (Drosophila melanogaster)Actin-5c, Drosophila U6Puromycin Liu Mutagenesis and homologous recombination in Drosophila cell lines using CRISPR/Cas9. Biol Open. 2013 Dec 10. pii: bio.20137120v1. doi: 10.1242/bio.20137120. Expresses sgRNA and Cas9-Puro in Drosophila S2 cells pAc-STABLE1-Puro
    pRB14S. pyogenes cas9 with humanized codon bias (Other)tubulin Foerstemann Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination donors in cultured Drosophila cells. Nucleic Acids Res. 2014 Apr 19. expresses a myc-tagged version of hCas9 in Drosophila pCASPER5
    pDCC6Cas9 (Synthetic), U6-2>sgRNA (Synthetic)hsp70Bb, U6-96Ab Duchek Efficient CRISPR/Cas9 Plasmids for Rapid and Versatile Genome Editing in Drosophila. G3 (Bethesda). 2014 Sep 17. pii: g3.114.014126. doi: 10.1534/g3.114.014126. Bi-cistronic Drosophila CRISPR/Cas9 vector, contains hsp70>Cas9 and U6>sgRNA cassette pHW
    pnos-Cas9-noscas9nanos Bullock Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500. Expresses Cas9 under control of nanos promoter and 3'UTR. For germ line restricted genome engineering in Drosophila melanogaster. pnos
    pAct-Cas9cas9act5C Bullock Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500. Expresses Cas9 under control of act5C promoter and SV40 3'UTR. For ubiquitous genome engineering in Drosophila melanogaster. pact
    p(bhsp68-Cas9)Cas9 (Other)bhsp Averof Efficient CRISPR-mediated gene targeting and transgene replacement in the beetle Tribolium castaneum. Development. 2015 Jul 9. pii: dev.125054. Tribolium basal heat shock promoter driving Cas9 pSLfa[Tc-bhsp68::nlsEGFP]fa
    act-AsCpf1hAsCpf1 (Homo sapiens)act5C Bullock Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nat Methods. 2016 Oct;13(10):852-4. doi: 10.1038/nmeth.3972. Epub 2016 Sep 5. expression plasmid of AsCpf1 pact
    nos-Cas9.874Z1hSpCas9 (Other)nanosdsRed Akbari Transforming insect population control with precision guided sterile males with demonstration in flies Nature Communications (2019) volume 10, Article number: 84 Express hSpCas9 under nanos promoter piggyBac+attB
    Ubiq-Cas9.874WhSpCas9 (Other)Ubiquitin-63E promoterdsRed Akbari Transforming insect population control with precision guided sterile males with demonstration in flies Nature Communications (2019) volume 10, Article number: 84 Express hSpCas9 under Ubiquitin-63E promoter piggyBac+attB
    vas-Cas9.874ZhSpCas9 (Other)vasadsRed Akbari Transforming insect population control with precision guided sterile males with demonstration in flies Nature Communications (2019) volume 10, Article number: 84 Express hSpCas9 under vasa promoter piggyBac+attB
    pCRISPaint-T2A-Cas9-T2A-GFP-3xP3-RFPCas9-T2A-GFP Perrimon Gene Knock-Ins in Drosophila Using Homology-Independent Insertion of Universal Donor Plasmids. Genetics. 2019 Nov 4. pii: genetics.119.302819. doi: 10.1534/genetics.119.302819. CRISPaint universal donor plasmid for gene exon insertion. Encodes T2A-Cas9-T2A-GFP-SV40 and 3xP3-RFP visible eye marker. pCRISPaint-T2A-Gal4-3xP3-RFP digested with NheI/KpnI
    pMK33/Cas9Drosophila-optimized Cas9 (Other) Perrimon Pooled genome-wide CRISPR screening for basal and context-specific fitness gene essentiality in Drosophila cells. Elife. 2018 Jul 27;7. pii: 36333. doi: 10.7554/eLife.36333. Expresses drosophila-optimized Cas9 pMK33
    pBFv-nosP-Cas9Cas9-NLSUASvermilion (expression very weak) Kondo Highly improved gene targeting by germline-specific Cas9 expression in Drosophila. Genetics. 2013 Nov;195(3):715-21. doi: 10.1534/genetics.113.156737. Epub 2013 Sep 3. Expresses Cas9 in the germline of Drosophila pBluescriptII SK (+)


    Plasmid Gene/Insert Promoter Selectable Marker PI Publication Hidden Extra Search Info
    pK7WGF2::hCas9hCas9 (Synthetic)35SKanamycin Kamoun Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655. Expesses the human codon usage Cas9 nuclease (Mali et al. Science 339, 823-826, 2013) with an N-terminal GFP tag from the 35S promoter in the plant tissue pK7WGF2
    pICH41308::hCas9hCas9 (Synthetic) Kamoun Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 2013 Oct 11;9(1):39. Level 0 hCas9 module pICH41308
    pICH47742::2x35S-5’UTR-hCas9(STOP)-NOST35Sp::hCas9 (Synthetic) Kamoun Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 2013 Oct 11;9(1):39. Level 1 hCas9 module pICH47742
    pAGM4723::AtU6p::sgRNA2-2x35S-5′UTR::Cas9::NOST-AtU6p::sgRNA1sgRNA_PDS2-Cas9-sgRNA_PDS1 (Synthetic) Kamoun Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 2013 Oct 11;9(1):39. Level 2 construct pAGM4723
    pBUN4113×FLAG-NLS-zCas9-NLS (Synthetic), gRNA scaffold (Synthetic)Ubi1p, OsU3pBar Chen A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327. CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistance pGreen-like binary vector
    pHSN4013×FLAG-NLS-zCas9-NLS (Synthetic), gRNA scaffold (Synthetic)2×35Sp, AtU6-26pHygromycin Chen A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327. CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistance pGreen-like binary vector
    pRGE31Rice snoRNA U3 and dual 35S promoter Yang RNA-Guided Genome Editing in Plants Using a CRISPR-Cas System. Mol Plant. 2013 Nov;6(6):1975-83. doi: 10.1093/mp/sst119. Epub 2013 Aug 17. Expressing sgRNA and Cas9 in plants. The sgRNA was controlled by rice snoRNA U3 promoter pUGW11
    pRGEB31Rice snoRNA U3 and dual 35S promoterHygromycin Yang RNA-Guided Genome Editing in Plants Using a CRISPR-Cas System. Mol Plant. 2013 Nov;6(6):1975-83. doi: 10.1093/mp/sst119. Epub 2013 Aug 17. Binary vector derived from pRGE31. Deliver sgRNA and Cas9 into plant. by agrobacterium mediated transformation. pCAMBIA1300
    HBT-pcoCas9pcoCas9 (Synthetic)hybrid constitutive promoter 35SPPDK Sheen Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol. 2013 Aug;31(8):688-91. doi: 10.1038/nbt.2654. transient expression of pcoCas9 gene in plant cells HBT-FLAG
    pFGC-pcoCas935SPPDK:pcoCas9:NOS cassette (Synthetic)constitutive 35SPPDK promoterBasta Sheen Sheen lab CRISPR plasmids (unpublished) A binary plasmid containing 35SPPDK:pcoCas9:NOS cassette for plant expression of Cas9 and multiple cloning sites for insertion of guide RNA pFGC-RCS
    pJIT163-2NLSCas9Cas9 (Other)2x35S Gao Targeted genome modification of crop plants using a CRISPR-Cas system. Nat Biotechnol. 2013 Aug;31(8):686-8. doi: 10.1038/nbt.2650. Expression of rice codon-optimized Cas9 in plant cells pJIT163
    p201N Cas9Cas9 (Synthetic), nptII (Other)2x35S, StUbi-3PG418, kanamycin Parrott Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16 Cas9 driven by double 35S, nptII for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP
    p201H Cas9Cas9 (Synthetic), hph (Other)2x35S, StUbi-3PHygromycin Parrott Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16 Cas9 driven by double 35S, hygromycin resistance for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP
    p201B Cas9Cas9 (Synthetic), BAR (Other)2x35S, 2x35SBasta Parrott Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16 Cas9 driven by double 35S, BAR for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP
    p201G Cas9Cas9 (Synthetic), sGFP (Synthetic)2x35S, 2x35SGFP Parrott Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16 Cas9 driven by double 35S, GFP for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP
    Cas9 MDC123Glycine Max codon optimized Cas9 (Other)2X35SBasta Stupar CRISPR/Cas mutagenesis of soybean and Medicago truncatula using a new web-tool and a modified Cas9 enzyme. GM Crops Food. 2015;6(4):243-52. doi: 10.1080/21645698.2015.1106063. 2x35S promoting Glycing Max codon optimized Cas9 with bar plant selection pMDC123
    Cas9 MDC32Glycine Max codon optimized Cas9 (Other)2X35SHygromycin Stupar CRISPR/Cas mutagenesis of soybean and Medicago truncatula using a new web-tool and a modified Cas9 enzyme. GM Crops Food. 2015;6(4):243-52. doi: 10.1080/21645698.2015.1106063. 2x35S promoting Glycing Max codon optimized Cas9 with hygromycin plant selection pMDC32
    G10 Cas9 MDC123Glycine Max codon optimized Cas9 (Other)G10Basta Stupar CRISPR/Cas mutagenesis of soybean and Medicago truncatula using a new web-tool and a modified Cas9 enzyme. GM Crops Food. 2015;6(4):243-52. doi: 10.1080/21645698.2015.1106063. G10 promoting Glycing Max codon optimized Cas9 (N and C terminus NLS) with bar plant selection pMDC123
    pDe-CAS9Cas9 (Arabidopsis thaliana)PcUBI4-2Basta Puchta Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J. 2014 Jul;79(2):348-59. doi: 10.1111/tpj.12554. Epub 2014 Jun 17. Binary expression vector with codon-optimized Cas9 and Gateway destination sequence pPZP221
    pCAS9-TPCCas9 (Arabidopsis thaliana)PcUbi4-2Basta Puchta Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J. 2014 Jul;79(2):348-59. doi: 10.1111/tpj.12554. Epub 2014 Jun 17. Binary expression vector with codon-optimized Cas9 for conventional cloning pPZP221
    pBUE411gRNA scaffold (Synthetic), zCas9 (Other)OsU3, UbiBasta Chen A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327. CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistance pCambia
    pHSE401gRNA scaffold (Synthetic), zCas9 (Other)AtU6-26p, 35SHygromycin Chen A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327. CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistance pCambia
    pKSE401gRNA scaffold (Synthetic), zCas9 (Other)AtU6-26p, 35SNeomycin (select with G418) Chen A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327. CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Kan resistance pCambia
    pHUE411gRNA scaffold (Synthetic), zCas9 (Other)OsU3, UbiHygromycin Chen A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327. CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Hyg resistance pCambia
    pBUN421gRNA scaffold (Synthetic), zCas9 (Other)TaU3, UbiBasta Chen A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327. CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (TaU3 promoter), Bar resistance pGreen-like
    pRGEB32Rice snoRNA U3 promoter for gRNA/PTG expression and UBI promoter for Cas9 expressionHygromycin Yang Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci U S A. 2015 Mar 17;112(11):3570-5. doi: 10.1073/pnas.1420294112. Epub 2015 Mar 2. Express sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated transformation. pRGEB31
    pRGE32Rice snoRNA U3 promoter for gRNA/PTG expression and UBI promoter for Cas9 expression Yang Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci U S A. 2015 Mar 17;112(11):3570-5. doi: 10.1073/pnas.1420294112. Epub 2015 Mar 2. Express sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for transient expression in protoplast pRGE31
    pYLCRISPR/Cas9Pubi-HCas9 (Other)maize ubiquitin promoter (Pubi)Hygromycin Liu A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007. expression of Cas9 in plants, maize ubiquitin promoter (Pubi), hygro selection pCAMBIA1300
    pYLCRISPR/Cas9Pubi-BCas9 (Other)maize ubiquitin promoter (Pubi)Basta Liu A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007. expression of Cas9 in plants, maize ubiquitin promoter (Pubi), basta selection pCAMBIA1300
    pYLCRISPR/Cas9P35S-HCas9 (Other)cauliflower mosaic virus 35S promoter (P35S)Hygromycin Liu A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007. expression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), hygro selection pCAMBIA1300
    pYLCRISPR/Cas9P35S-BCas9 (Other)cauliflower mosaic virus 35S promoter (P35S)Basta Liu A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007. expression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), basta selection pCAMBIA1300
    pYLCRISPR/Cas9P35S-NCas9 (Other)cauliflower mosaic virus 35S promoter (P35S)Neomycin (select with G418) Liu A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007. expression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), Neo selection pCAMBIA1300
    pEGB2alpha2 35s:hCas9:tNos (GB0639)hCas9 (Other)35S Orzaez GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiol. 2013 Jul;162(3):1618-31. Transcriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter pDGB2alpha2
    pICSL11056Promoter/5UTR: ZmUbi + CDS:SpCas9 + 3UTR/terminator:35s (Other) Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. Level 1 Golden Gate Cassette: Cas9 expression cassette for monocotyledonous plants pICH47742 (AddGene #47742)
    pICSL11060Promoter/5UTR: CsVMV+ CDS:SpCas9 + 3UTR/terminator:35s (Other) Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. Level 1 Golden Gate Cassette: Cas9 expression cassette for plants (exemplified in Brassica oleracea) pICH47742 (AddGene #47742)
    pYPQ150pcoCas9 (plant codon-optimized) (Other) Qi A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol. 2015 Aug 21. pii: pp.00636.2015. Gateway entry vector with pcoCas9 (Plant codon optimized) pNJB91
    pYPQ154AteCas9 (Arabidopsis codon optimized) (Other) Qi A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol. 2015 Aug 21. pii: pp.00636.2015. Gateway entry vector with AteCas9 (Arabidopsis codon optimized) pYPQ185-linker2
    pYPQ158hSpCas9 (Human codon optimized) (Other) Qi A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol. 2015 Aug 21. pii: pp.00636.2015. Gateway entry vector with hSpCas9 (Human codon optimized) pNJB185-linker6
    pYPQ167Cas9p (Plant codon-optimized; high GC content at 5 prime region) (Other) Qi A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol. 2015 Aug 21. pii: pp.00636.2015. Gateway entry vector with Cas9p pYPQ185-linker2
    pTC217Nuclease (Cas9/sgRNA) + Donor + GVR (Other)kanamycin Voytas High-frequency, precise modification of the tomato genome. Genome Biol. 2015 Nov 6;16(1):232. doi: 10.1186/s13059-015-0796-9. Cas9/sgRNA targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based on Bean Yellow Dwarf Virus; sgRNA= 1b pLSLR
    pTC223Nuclease (Cas9/sgRNA) + Donor + GVR (Other)kanamycin Voytas High-frequency, precise modification of the tomato genome. Genome Biol. 2015 Nov 6;16(1):232. doi: 10.1186/s13059-015-0796-9. Cas9/sgRNA targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based on Bean Yellow Dwarf Virus; sgRNA= 7 pLSLR
    pHEE401sgRNA scaffold (Synthetic), zCas9 (Other)U6-26p Arabidopsis U6 gene promoter, EC1.2 promoterHygromycin Chen Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0. Egg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistance pCambia
    pHEE401EgRNA scaffold (Synthetic), zCas9 (Other)U6-26p Arabidopsis U6 gene promoter, EC1.2 enhancer fused to EC1.1 promoterHygromycin Chen Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0. Egg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistance pCambia
    pHEE2E-TRIsgRNA targeting TRY and CPC genes (Synthetic), sgRNA targeting ETC2 gene (Synthetic), zCas9 (Other)U6-26p Arabidopsis U6 gene promoter, U6-26p Arabidopsis U6 gene promoter, EC1.2 enhancer fused to EC1.1 promoterHygromycin Chen Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0. Egg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPC pCambia
    pMpGE010Hygromycin Kohchi Efficient CRISPR/Cas9-based genome editing and its application to conditional genetic analysis in Marchantia polymorpha. PLoS One. 2018 Oct 31;13(10):e0205117. doi: 10.1371/journal.pone.0205117. eCollection 2018. For CRISPR/Cas9 genome editing in Marchantia polymorpha pMpGWB103
    pMpGE011Chlorsulfuron Kohchi Efficient CRISPR/Cas9-based genome editing and its application to conditional genetic analysis in Marchantia polymorpha. PLoS One. 2018 Oct 31;13(10):e0205117. doi: 10.1371/journal.pone.0205117. eCollection 2018. For CRISPR/Cas9 genome editing in Marchantia polymorpha pMpGWB303
    pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)hCas9 (Other)35S Orzaez A modular toolbox for gRNA-Cas9 genome engineering in plants based on the GoldenBraid standard. Plant Methods. 2016 Feb 1;12:10. doi: 10.1186/s13007-016-0101-2. eCollection 2016. Transcriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181. pDGB2omega2
    pBAtCU6Basta Kim A simple, flexible and high-throughput cloning system for plant genome editing via CRISPR-Cas system. J Integr Plant Biol. 2016 Mar 4. doi: 10.1111/jipb.12474. Plant expression of Cas9 and gRNA empty backbone; Basta resistance pB2GW7
  • Tag / Fusion Protein
    • NLS-HA (C terminal on insert)
  • pHAtCU6Hygromycin Kim A simple, flexible and high-throughput cloning system for plant genome editing via CRISPR-Cas system. J Integr Plant Biol. 2016 Mar 4. doi: 10.1111/jipb.12474. Plant expression of Cas9 and gRNA empty backbone; Hygro Resistance pH2GW7
    pHDE-35S-Cas9-mCherryHygromycin ; mCherry fluorescence Zhao An effective strategy for reliably isolating heritable and Cas9-free Arabidopsis mutants generated by CRISPR/Cas9-mediated genome editing. Plant Physiol. 2016 May 15. pii: pp.00663.2016. For CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plants pHDE
    pHDE-35S-Cas9-mCherry-UBQHygromycin ; mCherry fluorescence Zhao An effective strategy for reliably isolating heritable and Cas9-free Arabidopsis mutants generated by CRISPR/Cas9-mediated genome editing. Plant Physiol. 2016 May 15. pii: pp.00663.2016. For CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plants. Enable production of two gRNAs pHDE
    pKIR1.1human-codon-optimized SpCas9 (Other)AtRPS5AHygromycin ; TagRFP in seeds Higashiyama pKAMA-ITACHI vectors for highly efficient CRISPR/Cas9-mediated gene knockout in Arabidopsis thaliana. Plant Cell Physiol. 2016 Nov 17. pii: pcw191. CRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter pFAST-R01
    pKI1.1human-codon-optimized SpCas9 (Other)AtRPS5A Higashiyama pKAMA-ITACHI vectors for highly efficient CRISPR/Cas9-mediated gene knockout in Arabidopsis thaliana. Plant Cell Physiol. 2016 Nov 17. pii: pcw191. CRISPR/Cas9 for Arabidopsis in pENTR/D-TOPO pENTR/D-TOPO
    pKI1.1Rhuman-codon-optimized SpCas9 (Other)AtRPS5AHygromycin ; TagRFP in seeds Higashiyama pKAMA-ITACHI vectors for highly efficient CRISPR/Cas9-mediated gene knockout in Arabidopsis thaliana. Plant Cell Physiol. 2016 Nov 17. pii: pcw191. CRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter. pFAST-R01
    pAGM4723:TpCC_UreaseCas9 (Other), Urease-targeting gRNA 1 (Other), Urease-targeting gRNA 2 (Other)FCP, U6, U6Nourseothricin (Nat) Mock Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana Plant Methods 2016, 12:49 Golden Gate Level 2 construct encoding Cas9-YFP and 2 urease-targeting gRNAs pAGM4723
    pICH47742:FCP:Cas9YFPCas9 (Other)FCP Mock Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana Plant Methods 2016, 12:49 Golden Gate Level 1 cassette encoding a Cas9-YFP fusion under the FCP promoter pICH47742
    pYPQ220 (AsCpf1)AsCpf1 (Other) Qi A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nat Plants. 2017 Feb 17;3:17018. doi: 10.1038/nplants.2017.18. AsCpf1 Gateway entry plasmid pYPQ167
    pYPQ230 (LbCpf1)LbCpf1 (Other) Qi A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nat Plants. 2017 Feb 17;3:17018. doi: 10.1038/nplants.2017.18. LbCpf1 Gateway entry plasmid pYPQ167
    pKIR1.0human-codon-optimized SpCas9 (Other)AtRPS5ATagRFP in seeds Higashiyama pKAMA-ITACHI vectors for highly efficient CRISPR/Cas9-mediated gene knockout in Arabidopsis thaliana. Plant Cell Physiol. 2016 Nov 17. pii: pcw191. CRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter. pFAST-R01
    pUB-Cas9Cas9 (Synthetic)UBIQUITIN10Hygromycin Weber An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana. Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017. For ubiquitous expression of Cas9 in planta. sgRNA can be introduced as described in Hahn et al. (2017) pKB65
    [email protected]sgRNA against GLABROUS1 (Synthetic)Arabidopsis U6-26 promoterHygromycin Weber An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana. Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017. Disruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9 pUB-Cas9
    pTX168Hygromycin Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express STU (Single Transcriptional Unit) Cas9 with CaMV 35s promoter in plants pCAMBIA1300
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • pTX171Hygromycin Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express STU (Single Transcriptional Unit) Cas9 with CaMV 35s promoter in plants pTX168
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • pTX172Hygromycin Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express STU (Single Transcriptional Unit) Cas9 with Maize Ubiquitin1 promoter in plants pTX171
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • pTX176Hygromycin Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express estrodial-inducible STU (Single Transcriptional Unit) Cas9 in plants pTX171
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • pJG80TaCas9 (Other) Voytas High-efficiency gene targeting in hexaploid wheat using DNA replicons and CRISPR/Cas9. Plant J. 2016 Dec 10. doi: 10.1111/tpj.13446. Entry vector containing TaCas9-nos terminator between attL1 and attR5 sites unknown
    pMOD_A0108 AtCas9 (Synthetic) EC1.2 Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Module A, Promoter: EC1.2, Gene: AtCas9, Terminator: HSP pMOD_A1001
    pMOD_A0502 Csy4-P2A-AtCas9 (Synthetic) AtUbi10 Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Module A, Promoter: AtUbi10, Gene: Csy4-P2A-AtCas9, Terminator: HSP pMOD_A1001
    pMOD_A0508 Csy4-P2A-AtCas9 (Synthetic) EC1.2 Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Module A, Promoter: EC1.2, Gene: Csy4-P2A-AtCas9, Terminator: HSP pMOD_A1001
    pMOD_A0901 TREX2-P2A-AtCas9 (Synthetic) 35S Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Module A, Promoter: 35S, Gene: TREX2-P2A-AtCas9, Terminator: HSP pMOD_A1001
    pMOD_A0908 TREX2-P2A-AtCas9 (Synthetic) EC1.2 Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Module A, Promoter: EC1.2, Gene: TREX2-P2A-AtCas9, Terminator: HSP pMOD_A1001
    pMOD_A1110 TaCas9 (Synthetic) ZmUbi Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Module A, Promoter: ZmUbi, Gene: TaCas9, Terminator: HSP pMOD_A1001
    pMOD_A1111 TaCas9 (Synthetic) OsAct1 Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Module A, Promoter: OsAct1, Gene: TaCas9, Terminator: HSP pMOD_A1001
    pMOD_A1510 Csy4-P2A-TaCas9 (Synthetic) ZmUbi Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Module A, Promoter: ZmUbi, Gene: Csy4-P2A-TaCas9, Terminator: HSP pMOD_A1001
    pMOD_A1511 Csy4-P2A-TaCas9 (Synthetic) OsAct1 Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Module A, Promoter: OsAct1, Gene: Csy4-P2A-TaCas9, Terminator: HSP pMOD_A1001
    pDIRECT_21A Engineering Reagent: 35S:AtCas9 + AtU6:gRNA (Synthetic)Hygromycin Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:hpt II pTRANS_210
    pDIRECT_21C Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers (Synthetic)Hygromycin Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers , Plant Selection: 2x35S:hpt II pTRANS_210d
    pDIRECT_22A Engineering Reagent: 35S:AtCas9 + AtU6:gRNA (Synthetic)Kanamycin Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:npt II pTRANS_220
    pDIRECT_22C Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers (Synthetic)Kanamycin Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers , Plant Selection: 2x35S:npt II pTRANS_220d
    pDIRECT_23A Engineering Reagent: 35S:AtCas9 + AtU6:gRNA (Synthetic)Basta Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:bar pTRANS_230
    pDIRECT_23C Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers (Synthetic)Basta Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers , Plant Selection: 2x35S:bar pTRANS_230d
    pDIRECT_25F Engineering Reagent: ZmUbi:TaCas9 + TaU6:gRNA (Synthetic)Hygromycin Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Direct Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9 + TaU6:gRNA, Plant Selection: PvUbi2:hpt II pTRANS_250d
    pDIRECT_25H Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers (Synthetic)Hygromycin Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Direct Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt II pTRANS_250d
    pDIRECT_26H Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers (Synthetic)Basta Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Direct Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:bar pTRANS_260d
    pAtCas9_1 AtCas9 (Synthetic)Hygromycin Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Cas9 only expression, Cas9 Type: AtCas9, Plant Selection: 2x35S:hpt II pCAMBIA
    pAtCas9_3 AtCas9 (Synthetic)Basta Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Cas9 only expression, Cas9 Type: AtCas9, Plant Selection: 2x35S:bar pCAMBIA
    pTaCas9_5 TaCas9 (Synthetic)Hygromycin Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Cas9 only expression, Cas9 Type: TaCas9, Plant Selection: PvUbi2:hpt II pCAMBIA
    pTaCas9_6 TaCas9 (Synthetic)Basta Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Cas9 only expression, Cas9 Type: TaCas9, Plant Selection: PvUbi2:bar pCAMBIA
    pDIRECT_10A35S:AtCas9 + AtU6:gRNA (Synthetic) Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. Direct Cloning, Type: non-T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: none pTRANS_100
    pKEE401Neomycin (select with G418) Chen Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0. CRISPR/Cas9-mediated genome editing in Arabidopsis. Contains Cas9 and empty gRNA scaffold, Kan resistance pCambia
    pXEE401B Chen Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0. CRISPR/Cas9-mediated genome editing in Arabidopsis. Contains Cas9 and empty gRNA scaffold, Bar resistance pCambia
    pXEE401BG Chen Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0. CRISPR/Cas9-mediated genome editing in Arabidopsis, Bar and glyphosate-resistance pCambia
    pSC10 Stupar CRISPR/Cas9 and TALENs generate heritable mutations for genes involved in small RNA processing of Glycine max and Medicago truncatula. Plant Biotechnol J. 2017 Oct 31. doi: 10.1111/pbi.12857. pAH595-gRNA 2xplex entry cassette pENTR top
    pSC12 Stupar CRISPR/Cas9 and TALENs generate heritable mutations for genes involved in small RNA processing of Glycine max and Medicago truncatula. Plant Biotechnol J. 2017 Oct 31. doi: 10.1111/pbi.12857. pNB184-Cas9 entry cassette pENTR top
    pYLCRISPR/Cas9pUbi-NCas9 (Synthetic)ZmUbi Liu A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007. Expression of Cas9 in plants, ZmUbi promoter, Kanamycin selection pCAMBIA1300
    pJKW0458p35S Weng pJKW0457 (unpublished) p35S:CAS9 pEarleyGate100
    pJKW0474Arabidopsis CLAVATA3 Weng pJKW0457 (unpublished) pCLV3:Cas9 pEarleyGate100
    pMpGE006Atco-Cas9-Pea3ter (Synthetic)MpEFproHygromycin Sugano Efficient CRISPR/Cas9-based genome editing and its application to conditional genetic analysis in Marchantia polymorpha. PLoS One. 2018 Oct 31;13(10):e0205117. doi: 10.1371/journal.pone.0205117. eCollection 2018. Cas9 expression in M.polymorpha pMpGWB103
    pYPQ239FnCpf1 (Other) Qi Plant Genome Editing Using FnCpf1 and LbCpf1 Nucleases at Redefined and Altered PAM Sites. Mol Plant. 2018 Jul 2;11(7):999-1002. doi: 10.1016/j.molp.2018.03.008. Epub 2018 Mar 20. FnCpf1 Gateway entry plasmid pYPQ167
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
  • pYPQ230-RRLbCpf1-RR (LbCpf1 with G548R and K611R mutations) (Other) Qi Plant Genome Editing Using FnCpf1 and LbCpf1 Nucleases at Redefined and Altered PAM Sites. Mol Plant. 2018 Jul 2;11(7):999-1002. doi: 10.1016/j.molp.2018.03.008. Epub 2018 Mar 20. LbCpf1 Gateway entry plasmid with G548R and K611R mutations pYPQ167
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
  • pYPQ230-RVRLbCpf1-RVR (LbCpf1 with G548R, K554V and Y558R mutations) (Other) Qi Plant Genome Editing Using FnCpf1 and LbCpf1 Nucleases at Redefined and Altered PAM Sites. Mol Plant. 2018 Jul 2;11(7):999-1002. doi: 10.1016/j.molp.2018.03.008. Epub 2018 Mar 20. LbCpf1 Gateway entry plasmid with G548R, K554V and Y558R mutations pYPQ167
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
  • pYPQ239-RRFnCpf1-RR (FnCpf1 with N623R and K687R mutations) (Other) Qi Plant Genome Editing Using FnCpf1 and LbCpf1 Nucleases at Redefined and Altered PAM Sites. Mol Plant. 2018 Jul 2;11(7):999-1002. doi: 10.1016/j.molp.2018.03.008. Epub 2018 Mar 20. FnCpf1 Gateway entry plasmid with N623R and K687R mutations pYPQ167
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
  • pYPQ239-RVRFnCpf1-RVR (FnCpf1 with N623R, K629R and N633R mutations) (Other) Qi Plant Genome Editing Using FnCpf1 and LbCpf1 Nucleases at Redefined and Altered PAM Sites. Mol Plant. 2018 Jul 2;11(7):999-1002. doi: 10.1016/j.molp.2018.03.008. Epub 2018 Mar 20. FnCpf1 Gateway entry plasmid with N623R, K629R and N633R mutations pYPQ167
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
  • pORFE0001AtCAS9 (Other) Chevalier Chevalier Lab plasmids (unpublished) AtCas9 module CDS1 pICH41308
    pORFE1001AtCAS9 (Other)2x35S Chevalier Chevalier Lab plasmids (unpublished) Overexpression of the AtCAS9 in plant under 2x35S promoter pICH47742
    pMH-Cas9-gateCas9 (Other)Z. Mays ubiquitin promoter, 35S promoterHygromycin Bezanilla Efficient and modular CRISPR-Cas9 vector system for Physcomitrella patens. Plant Direct. 2019 Sep 12;3(9):e00168. doi: 10.1002/pld3.168. eCollection 2019 Sep. Gateway destination vector encoding Maize ubiquitin promoter driving Cas9 and 35S promoter driving hygromycin for selection in plants. pGEM-T easy
    pMK-Cas9-gateCas9 (Other)Z. Mays ubiquitin promoter, 35S promoterNeomycin (select with G418) Bezanilla Efficient and modular CRISPR-Cas9 vector system for Physcomitrella patens. Plant Direct. 2019 Sep 12;3(9):e00168. doi: 10.1002/pld3.168. eCollection 2019 Sep. Gateway destination vector encoding Maize ubiquitin promoter driving Cas9 and 35S promoter driving aminoglycoside phosphotransferase for G418 selection in plants. pGEM-T easy
    pZeo-Cas9-gateCas9 (Other)Z. Mays ubiquitin promoter, 35S promoterZeocin Bezanilla Efficient and modular CRISPR-Cas9 vector system for Physcomitrella patens. Plant Direct. 2019 Sep 12;3(9):e00168. doi: 10.1002/pld3.168. eCollection 2019 Sep. Gateway destination vector encoding Maize ubiquitin promoter driving Cas9 and 35S promoter driving Zeocin for selection in plants. pGEM-T easy
    BCJJ339BpiI:GCAA:RPS5a:Cas9-3(intron):E9:ACTA:BpiI (Arabidopsis thaliana)AtRPS5a Jones Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis bioRxiv 419952 RPS5a:Cas9:E9 Golden Gate Level 1 Position 2 pICH47742
    BCJJ340BpiI:GCAA:UBI10:Cas9-3(intron):E9:ACTA:BpiI (Synthetic)AtUBI10 Jones Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis bioRxiv 419952 UBI10:Cas9:E9 Golden Gate Level 1 Position 2 pICH47742
    BCJJ344BpiI:tagt:UBI10:Cas9-3(intron):E9:ttgc:BpiI (Synthetic)AtUBI10 Jones Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis bioRxiv 419952 UBI10:Cas9:E9 Golden Gate Level 1 Position 2 reverse pICH47811
    BCJJ345BpiI:tagt:YAO:Cas9-3(intron):E9:ttgc:BpiI (Synthetic)AtYAO Jones Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis bioRxiv 419952 YAO:Cas9:E9 Golden Gate Level 1 Position 2 reverse pICH47811
    BCJJ358BpiI:tagt:RPS5a:Cas9_4:E9:ttgc:BpiI (Synthetic)AtRPS5a Jones Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis bioRxiv 419952 RPS5a:Cas9:E9 Golden Gate Level 1 Position 2 reverse pICH47811
    pICSL90016BsaI:AATG:Cas9_2:GCTT:BsaI (Synthetic) Jones Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis bioRxiv 419952 Cas9_2 Golden Gate Level 0 pICH41308
    BCJJ125BsaI:AATG:Cas9_3(intron):GCTT:BsaI (Synthetic) Jones Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis bioRxiv 419952 Cas9_3 (with intron) Golden Gate Level 0 pICH41308
    BCJJ180BsaI:AATG:Cas9_4:GCTT:BsaI (Synthetic) Jones Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis bioRxiv 419952 Cas9_4 Golden Gate Level 0 pICH41308
    pICSL90005 SpCas9-h (no stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, SpCas9-h (no stop codon) pAGM1287
    pEPOR0SP0013SpCas9-p (with stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, SpCas9-p pICH41308
    pEPOR0SP0009SpCas9-p (no stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, SpCas9-p (no stop codon) pAGM1287
    pEPOR0SP0001SpCas9-DE (no stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, SpCas9-DE (no stop codon) pAGM1287
    pEPOR0SP0014SpCas9-KA (with stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, SpCas9-KA pICH41308
    pEPOR0SP0015SpCas9-KA (no stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, SpCas9-KA (no stop codon) pAGM1287
    pEPOR0SP0016Sp-eCas9 1.0 (with stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, Sp-eCas9 1.0 pICH41308
    pEPOR0SP0017Sp-eCas9 1.0 (no stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, Sp-eCas9 1.0 (no stop codon) pAGM1287
    pEPOR0SP0018Sp-eCas9 1.1 (with stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, Sp-eCas9 1.1 pICH41308
    pEPOR0SP0019Sp-eCas9 1.1 (no stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, Sp-eCas9 1.1 (no stop codon) pAGM1287
    pEPOR0SP0011Sp-xCas9 3.7 (no stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, Sp-xCas9 3.7 (no stop codon) pAGM1287
    pEPOR0SP0020SaCas9 (with stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, SaCas9 pICH41308
    pEPOR0SP0021SaCas9 (no stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, SaCas9 (no stop codon) pAGM1287
    pEPOR0SP0012eSaCas9 (no stop codon) (Other) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level0 Golden Gate part: CDS, eSaCas9 (no stop codon) pAGM1287
    pICSL110232x35S+5'UTR OMEGA (pICH51288) + SpCas9-h (no stop codon)(pICSL90005) + YFP (pICSL50005)+ Nos (pICH41421) (Synthetic)2x35S_OMEGA(pICH51288) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level 1 Golden Gate Cassette: Cas9 expression cassette for dicotyledonous plants pICH47742
    pEPOR1CB00022x35S+5'UTR OMEGA (pICH51288) + SpCas9-p (no stop codon)(pEPOR0SP0009) + YFP (pICSL50005)+ Nos (pICH41421) (Synthetic)2x35S+5'UTR OMEGA (pICH51288) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level 1 Golden Gate Cassette: Cas9 expression cassette for dicotyledonous plants pICH47742
    pEPOR1CB00092x35S+5'UTR OMEGA (pICH51288) + SpCas9-KA (no stop codon)(pEPOR0SP0015) + YFP (pICSL50005)+ Nos (pICH41421) (Synthetic)2x35S+5'UTR OMEGA (pICH51288) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level 1 Golden Gate Cassette: Cas9-K855A expression cassette for dicotyledonous plants pICH47742
    pEPOR1CB00112x35S+5'UTR OMEGA (pICH51288) + Sp-eCas9 1.1 (no stop codon) (pEPOR0SP0019 + YFP (pICSL50005) + Nos (pICH41421) (Synthetic)2x35S+5'UTR OMEGA (pICH51288) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level 1 Golden Gate Cassette: eCas9 1.1 expression cassette for dicotyledonous plants pICH47742
    pEPOR1CB01122x35S+5'UTR OMEGA (pICH51288) + Sp-xCas9 3.7 (no stop codon) (pEPOR0SP0011) + YFP (pICSL50005) + Nos (pICH41421) (Synthetic)2x35S+5'UTR OMEGA (pICH51288) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level 1 Golden Gate Cassette: xCas9 3.7 expression cassette for dicotyledonous plants pICH47742
    pEPOR1CB00152x35S+5'UTR OMEGA (pICH51288) + SaCas9 (no stop codon) (pEPOR0SP0012) + YFP (pICSL50005) + Nos (pICH41421) (Synthetic)2x35S+5'UTR OMEGA (pICH51288) Patron Comparison of efficiency and specificity of CRISPR-associated (Cas) nucleases in plants: An expanded toolkit for precision genome engineering. bioRxiv 422766 Level 1 Golden Gate Cassette: SaCas9 expression cassette for dicotyledonous plants pICH47742
    p221z-CAS9p-t35sCAS9p (Other) Mähönen Plants CRISPR plasmids (unpublished) Entry clone containing CAS9p and 35S terminator. Used to make CRISPR construct . For use in plants and compatible with the MultiSite Gateway system pDONR-221z
    p221z-CAS9p-TagRFP-t35sCAS9p-TagRFP (Other) Mähönen Plants CRISPR plasmids (unpublished) Entry clone containing CAS9p-TagRFP and 35S terminator. Used to make CRISPR construct . For use in plants and compatible with the MultiSite Gateway system pDONR-221z
    pYPQ150-x3.7pcoCas9-x3.7 Qi Improving Plant Genome Editing with High-Fidelity xCas9 and Non-canonical PAM-Targeting Cas9-NG. Mol Plant. 2019 Mar 27. pii: S1674-2052(19)30124-8. doi: 10.1016/j.molp.2019.03.011. Gateway entry vector with pcoCas9-x3.7 (Plant codon optimized) pNJB91
    pGEL062Hygromycin Zhang Improving Plant Genome Editing with High-Fidelity xCas9 and Non-canonical PAM-Targeting Cas9-NG. Mol Plant. 2019 Mar 27. pii: S1674-2052(19)30124-8. doi: 10.1016/j.molp.2019.03.011. For genome editing in plant by SpCas9 wild type pZHY988
    pGEL063Hygromycin Zhang Improving Plant Genome Editing with High-Fidelity xCas9 and Non-canonical PAM-Targeting Cas9-NG. Mol Plant. 2019 Mar 27. pii: S1674-2052(19)30124-8. doi: 10.1016/j.molp.2019.03.011. For genome editing in plant by SpCas9 variant(SpCas9-NG) pZHY988
    pGEL065Hygromycin Zhang Improving Plant Genome Editing with High-Fidelity xCas9 and Non-canonical PAM-Targeting Cas9-NG. Mol Plant. 2019 Mar 27. pii: S1674-2052(19)30124-8. doi: 10.1016/j.molp.2019.03.011. For genome editing in plant by SpCas9 variant(SpCas9-NGv1) pZHY988
    pFH13SpCas9, wheat codon optimized Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 SpCas9, wheat codon optimized pICH41308
    pFH14SaCas9, Arabidopsis codon optimized (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 SaCas9, Arabidopsis codon optimized pICH41308
    pFH15SaCas9, Arabidopsis codon optimized (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 StCas9, Arabidopsis codon optimized pICH41308
    pFH16FnCas12a, rice codon optimized (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 FnCas12a, rice codon optimized pICH41308
    pFH17LbCas12a, rice codon optimized (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 LbCas12a, rice codon optimized pICH41308
    pFH22xCas9 3.7 (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 xCas9 3.7 pICH41308
    pFH32SpCas9-NG, human codon optimized (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 SpCas9-NG, human codon optimized pICH41308
    pFH46FnCas12a, human codon optimized (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 FnCas12a, human codon optimized pICH41308
    pFH47LbCas12a, human codon optimized (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 LbCas12a, human codon optimized pICH41308
    pFH48Csy4 (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 Csy4 pICH41308
    pFH76ScCas9, wheat codon optimized (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 ScCas9, wheat codon optimized pICH41308
    pFH77enCas9-PolI3M-TBD, wheat codon optimized (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 enCas9-PolI3M-TBD, wheat codon optimized pICH41308
    pRGEB32-BAR35S for BAR; Rice UBI for Cas9; Rice snoRNA U3 for gRNA/PTGBasta ; BAR Hunter CRISPR/Cas9 vector optimized for Agrobacterium-mediated transformation of maize (with BAR selectable marker) (modified from pRGEB32) (unpublished) For CRISPR/Cas9 delivery in maize. Expresses Cas9 with rice ubiquitin promoter, BAR with 35S promoter, and sgRNA/PTG with rice snoRNA U3 promoter (pol III). Can produce 1 or more gRNAs. pRGEB32
    pENTR_Wheat_live_Cas9Wheat_live_Cas9 (Synthetic) Kamoun Genome editing in wheat (unpublished) Gateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and BpiI sites for sgRNA modules. pENTR4
    pICSL11085_GG_Wheat_live_Cas9_forWheat_live_Cas9 (Synthetic) Kamoun Genome editing in wheat (unpublished) Encodes a wheat codon optimized Cas9 module in forward direction for golden gate cloning of genome editing binary plasmids. pICH47742
    pICSL11086_GG_Wheat_live_Cas9_revWheat_live_Cas9 (Synthetic) Kamoun Genome editing in wheat (unpublished) Encodes a wheat codon optimized Cas9 module in forward direction for golden gate cloning of genome editing binary plasmids. pICH47742
    pFH23ZmUBIp::SpCas9 (wheat codon optimized):NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 ZmUBIp::SpCas9 (wheat codon optimized):NOSt pICH47742
    pFH522x35Sp::SpCas9 (Arabidopsis codon optimized):NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 2x35Sp::SpCas9 (Arabidopsis codon optimized):NOSt pICH47742
    pFH532x35Sp::SpCas9 (Arabidopsis codon optimized):pea3At (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 2x35Sp::SpCas9 (Arabidopsis codon optimized):pea3At pICH47742
    pFH54AtUBI10p::SpCas9 (Arabidopsis codon optimized):pea3At (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 AtUBI10p::SpCas9 (Arabidopsis codon optimized):pea3At pICH47742
    pFH58ZmUBIp::SaCas9 (Arabidopsis codon optimized):NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 ZmUBIp::SaCas9 (Arabidopsis codon optimized):NOSt pICH47742
    pFH59ZmUBIp::StCas9 (Arabidopsis codon optimized):NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 ZmUBIp::StCas9 (Arabidopsis codon optimized):NOSt pICH47742
    pFH60ZmUBIp::FnCas12a (rice codon optimized):NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 ZmUBIp::FnCas12a (rice codon optimized):NOSt pICH47742
    pFH61ZmUBIp::LbCas12a (rice codon optimized):NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 ZmUBIp::LbCas12a (rice codon optimized):NOSt pICH47742
    pFH68ZmUBIp::SpCas9-NG (human codon optimized):NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 ZmUBIp::SpCas9-NG (human codon optimized):NOSt pICH47742
    pFH80ZmUBIp::xCas9 3.7:NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 ZmUBIp::xCas9 3.7:NOSt pICH47742
    pFH81ZmUBIp::ScCas9 (wheat codon optimized):NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 ZmUBIp::ScCas9 (wheat codon optimized):NOSt pICH47742
    pFH82ZmUBIp::enCas9-Poll3M-TBD (wheat codon optimized):NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 ZmUBIp::enCas9-Poll3M-TBD (wheat codon optimized):NOSt pICH47742
    pARS3_MUbCAS9_GWHygromycin Schaller Type-B response regulators of rice play key roles in growth, development, and cytokinin signaling. Development. 2019 Jun 3. pii: dev.174870. doi: 10.1242/dev.174870. T-DNA binary vector for CRISPR/Cas9 gene editing in rice; has a Gateway cassette for cloning gRNA pARS3
  • Tag / Fusion Protein
    • HA
  • pARS3_MUbCAS9_MCHygromycin Nimchuk Type-B response regulators of rice play key roles in growth, development, and cytokinin signaling. Development. 2019 Jun 3. pii: dev.174870. doi: 10.1242/dev.174870. T-DNA binary vector for CRISPR/Cas9 gene editing in rice; has a MCS for cloning gRNA pARS3
  • Tag / Fusion Protein
    • HA
  • pFH24SpCas9, wheat codon optimized, version 2 (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 SpCas9, wheat codon optimized (version 2) pICH41308
    pFH25SpCas9, wheat codon optimized, version 3 (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level0 SpCas9, wheat codon optimized (version 3) pICH41308
    pFH66ZmUBIp::SpCas9 (wheat codon optimized, version 2):NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 ZmUBIp::SpCas9 (wheat codon optimized, version 2):NOSt pICH47742
    pFH67ZmUBIp::SpCas9 (wheat codon optimized, version 3):NOSt (Synthetic) Nekrasov A modular cloning toolkit for genome editing in plants bioRxiv Level1 ZmUBIp::SpCas9 (wheat codon optimized, version 3):NOSt pICH47742
    pG3GB411CRISPR/Cas9 (Synthetic)gRNA- OsU3, zCas9-Ubi1 Chen A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Sep 26. pii: pp.19.00767. doi: 10.1104/pp.19.00767. pGreen3 CRISPR/Cas9 pGreen3
    pG3H-U3Ub CRISPR/Cas9 (Synthetic)gRNA- OsU3, zCas9-Ubi1 Chen A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Sep 26. pii: pp.19.00767. doi: 10.1104/pp.19.00767. pGreen3 CRISPR/Cas9 pGreen3
    pG3B-U3UbCRISPR/Cas9 (Synthetic)gRNA- OsU3, zCas9-Ubi1 Chen A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Sep 26. pii: pp.19.00767. doi: 10.1104/pp.19.00767. pGreen3 CRISPR/Cas9 pGreen3
    pG3B-U6SCCRISPR/Cas9 (Synthetic)gRNA-U6, zCas9-35SC Chen A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Sep 26. pii: pp.19.00767. doi: 10.1104/pp.19.00767. pGreen3 CRISPR/Cas9 pGreen3
    pG3K-U6SCCRISPR/Cas9 (Synthetic)gRNA-U6, zCas9-35SC Chen A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Sep 26. pii: pp.19.00767. doi: 10.1104/pp.19.00767. pGreen3 CRISPR/Cas9 pGreen3
    pG3H-U6SCCRISPR/Cas9 (Synthetic)gRNA-U6, zCas9-35SC Chen A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Sep 26. pii: pp.19.00767. doi: 10.1104/pp.19.00767. pGreen3 CRISPR/Cas9 pGreen3
    pG3B-U6EC1CRISPR/Cas9 (Synthetic)gRNA-U6, zCas9-EC1 Chen A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Sep 26. pii: pp.19.00767. doi: 10.1104/pp.19.00767. pGreen3 CRISPR/Cas9 pGreen3
    pG3K-U6EC1CRISPR/Cas9 (Synthetic)gRNA-U6, zCas9-EC1 Chen A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Sep 26. pii: pp.19.00767. doi: 10.1104/pp.19.00767. pGreen3 CRISPR/Cas9 pGreen3
    pG3H-U6EC1CRISPR/Cas9 (Synthetic)gRNA-U6, zCas9-EC1 Chen A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Sep 26. pii: pp.19.00767. doi: 10.1104/pp.19.00767. pGreen3 CRISPR/Cas9 pGreen3
    pGB411CRISPR/Cas9 (Synthetic) Chen A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Sep 26. pii: pp.19.00767. doi: 10.1104/pp.19.00767. pCambia CRISPR/Cas9 pCambia
    pGGA_RT_Sa_Cas9SaCAS9 (Synthetic) Theres Theres lab: Alternative Greengate/Goldengate modules (unpublished) Goldengate/Greengate module for genome editing, using the SaCAS9. pUC19
    pGEL077 Zhang Yong Zhang lab plasmids (unpublished) iSTU-CRISPR/Cas9 with StIV2 intron, NU structure backbone pZHY988
    pGEL078 Zhang Yong Zhang lab plasmids (unpublished) iSTU-CRISPR/Cas9 with StIV2 intron, tRNA structure backbone pZHY988
    pGEL079 Zhang Yong Zhang lab plasmids (unpublished) iSTU-CRISPR/Cas9 with StIV2 intron, RZ structure backbone pZHY988
    pGEL081 Zhang Yong Zhang lab plasmids (unpublished) iSTU-CRISPR/Cas9 with OsCDPK2 intron, tRNA structure backbone pZHY988
    pGEL082 Zhang Yong Zhang lab plasmids (unpublished) iSTU-CRISPR/Cas9 with OsCDPK2intron, RZ structure backbone pZHY988
    pGEL083 Zhang Yong Zhang lab plasmids (unpublished) iSTU-CRISPR/Cas9 with RcCat intron, NU structure backbone pZHY988
    pGEL085 Zhang Yong Zhang lab plasmids (unpublished) iSTU-CRISPR/Cas9 with RcCat intron, tRNA structure backbone pZHY988
    pGEL029 Zhang Single transcript unit CRISPR 2.0 systems for robust Cas9 and Cas12a mediated plant genome editing. Plant Biotechnol J. 2019 Jul;17(7):1431-1445. doi: 10.1111/pbi.13068. Epub 2019 Jan 17. STU2.0 SpyCas9 RZ system for plant genome editing pZHY988
    pGEL031 Zhang Single transcript unit CRISPR 2.0 systems for robust Cas9 and Cas12a mediated plant genome editing. Plant Biotechnol J. 2019 Jul;17(7):1431-1445. doi: 10.1111/pbi.13068. Epub 2019 Jan 17. STU2.0 SpyCas9 tRNA system for plant genome editing pZHY988
    pGEL033 Zhang Single transcript unit CRISPR 2.0 systems for robust Cas9 and Cas12a mediated plant genome editing. Plant Biotechnol J. 2019 Jul;17(7):1431-1445. doi: 10.1111/pbi.13068. Epub 2019 Jan 17. STU2.0 rAPOBEC1-SpyCas9(D10A) for plant genome base editing pZHY988
    pGEL050 Zhang Bidirectional Promoter-Based CRISPR-Cas9 Systems for Plant Genome Editing. Front Plant Sci. 2019 Sep 20;10:1173. doi: 10.3389/fpls.2019.01173. eCollection 2019. Dual-mini35S driven Cas9-Csy4 system pTX152
    pGEL051 Zhang Bidirectional Promoter-Based CRISPR-Cas9 Systems for Plant Genome Editing. Front Plant Sci. 2019 Sep 20;10:1173. doi: 10.3389/fpls.2019.01173. eCollection 2019. Dual-mini35S-enhancer driven Cas9-Csy4 system pTX152

    C. elegans

    Plasmid Gene/Insert Promoter Selectable Marker PI Publication Hidden Extra Search Info
    Peft-3::cas9-SV40_NLS::tbb-2 3'UTRcodon optimized Cas9_SV40 NLS with intron (Synthetic)eef-1A.1 (eft-3) Calarco Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532. pUC57
    pDD162 (Peft-3::Cas9 + Empty sgRNA)Cas9 (Synthetic), Empty sgRNA (Other)eef-1A.1 (eft-3) , U6 Goldstein Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641. Cas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome. pCFJ601
    SP6-hCas9-Ce-mRNAhCas9 with C. elegans 5' and 3' UTRs (Homo sapiens)SP6 Sternberg Transgene-Free Genome Editing in Caenorhabditis elegans Using CRISPR-Cas. Genetics. 2013 Aug 26. In vitro transcription of a mRNA encoding humanized Cas9 nuclease, with 3' UTRs suitable for germline expression in C. elegans, for doing CRISPR-Cas by RNA injection. Uses SP6 RNA polymerase. Bluescript
    pIK86Cas9 (Synthetic)T7 Katic Targeted Heritable Mutation and Gene Conversion by Cas9-CRISPR in Caenorhabditis elegans. Genetics. 2013 Aug 26. C. elegans codon-optimized Cas9 with 2xSV40 NLS sequences. It has a T7 promoter for in vitro transcription, germline-compatible 5'UTR, tbb-2 3'UTR and a polyA sequence. pUC57
    pMB62Cas9 (Synthetic)eef-1A.1 (eft-3) Boxem CRISPR/Cas9-Targeted Mutagenesis in Caenorhabditis elegans. Genetics. 2013 Aug 26. Expresses C. elegans optimized Cas9::mEGFP from the eef-1A.1 (eft-3) promoter pBluescript SK+
    pMB63Cas9 (Synthetic)eef-1A.1 (eft-3) Boxem CRISPR/Cas9-Targeted Mutagenesis in Caenorhabditis elegans. Genetics. 2013 Aug 26. Expresses C. elegans optimized Cas9 from the eef-1A.1 (eft-3) promoter pBluescript SK+
    pMB66Cas9 (Synthetic)hsp-16.48 Boxem CRISPR/Cas9-Targeted Mutagenesis in Caenorhabditis elegans. Genetics. 2013 Aug 26. Expresses C. elegans optimized Cas9::mEGFP from the hsp-16.48 promoter pBluescript SK+
    pMB67Cas9 (Synthetic)hsp-16.48 Boxem CRISPR/Cas9-Targeted Mutagenesis in Caenorhabditis elegans. Genetics. 2013 Aug 26. Expresses C. elegans optimized Cas9 from the hsp-16.48 promoter pBluescript SK+
    peft-3::cas-9::tbb-2 3'UTRcas9eef-1A.1 (eft-3) de Bono Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination. Nucleic Acids Res. 2013 Sep 5. this plasmid contains the codon optimized gene encoding Cas9 for C. elegans. pDEST