CRISPR Plasmids: Cut

Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism which frequently causes insertions or deletions (indels) in the DNA. Indels often lead to frameshifts, creating loss of function alleles.

To introduce specific genomic changes, researchers use ssDNA or dsDNA repair templates with 1. homology to the DNA flanking the DSB and 2. a specific edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental systems, HDR occurs at a much lower efficiency than NHEJ.

Browse, sort, or search the tables below for CRISPR plasmids designed to introduce a DSB.
Plasmids are available for expression in mammalian systems, bacteria, Drosophila, plants, C. elegans, yeast, zebrafish, and Xenopus.

Mammalian

Plasmid	Gene/Insert	Promoter	Selectable Marker	PI	Publication	Hidden Extra Search Info
hCas9	Cas9	CMV		Church	RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.	Expresses human codon optimized Cas9 nuclease for genome engineering pcDNA3.3-TOPO
pX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro	humanized S. pyogenes Cas9		Puromycin	Zhang	Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013 Jan 3.	This plasmid separately encodes a human codon-optimized SpCas9, a tracrRNA and customizable crRNA. pUC ori vector
pX330-U6-Chimeric_BB-CBh-hSpCas9	humanized S. pyogenes Cas9	CBh		Zhang	Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013 Jan 3.	A human codon-optimized SpCas9 and chimeric guide RNA expression plasmid. pUC ori vector Tag / Fusion Protein 3xFLAG (N terminal on insert)
pMJ920	Cas9 (Synthetic)	CMV		Doudna	RNA-programmed genome editing in human cells. elife. 2013;2:e00471. doi: 10.7554/eLife.00471. Epub 2013 Jan 29.	MacroLab 6D
JDS246	mammalian codon-optimized streptococcus pyogenes Cas9 - 3X Flag	CMV		Joung	Joung lab unpublished CRISPR plasmids (unpublished)	Expresses mammalian codon optimized Cas9 nuclease with C-term 3X FLAG from CMV and T7 promoters unknown
p3s-Cas9HC	Cas9	CMV		Kim	Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2507.	pCDNA3.1
pCas9_GFP	Cas9-2A-GFP (Synthetic)	CAG		Musunuru	Cas9 GFP plamsids (unpublished)	Co-expression of human codon-optimized Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells pCAG
pST1374-NLS-flag-linker-Cas9	Human codon optimized Cas9	CMV	Blasticidin	Huang	Generation of gene-modified mice via Cas9/RNA-mediated gene targeting. Cell Res. 2013 Apr 2. doi: 10.1038/cr.2013.46.	pST1374 (Addgene #13426)
pSimpleII-NLS-NmCas9-HA-NLS(s)	NmCas9 (Other)	EF1a		Thomson	Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12.	This plasmid encode NmCas9 with two NLS and a HA tag pSimpleII
pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s)	NmCas9 (Other), U6pr-tracrRNA (Other)	EF1a, U6		Thomson	Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12.	This plasmid contains expression cassette for NmCas9 with N and C NLS and an HA tag, a cassette for expression of tracrRNA, a cassette for cloning crRNA under the control of U6 promoter. pSimpleII
pSimpleII-NmCas9-FLAG	NmCas9 (Other)			Thomson	Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12.	FLAG tagged NmCas9 with no NLS. pSimpleII
pSpCas9 (PX165)	hSpCas9 (Synthetic)	Cbh		Zhang	Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24.	Human codon optimized Cas9 nuclease from Streptococcus pyogenes (Cbh-3X-FLAG-NLS-SpCas9-NLS) PX165
pSpCas9(BB)-2A-GFP (PX458)	hSpCas9 (Synthetic)	Cbh		Zhang	Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24.	Cas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNA PX458
pSpCas9(BB)-2A-Puro (PX459)	hSpCas9-2A-Puro (Synthetic)	Cbh	Puromycin	Zhang	Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24.	NOTE: A new version of this plasmid is now available. See Addgene plasmid 62988. PX459
pCAG-T3-hCAS-pA	Codon optimized Cas9 (Synthetic)	CAG promoter		Fujii	Efficient generation of large-scale genome-modified mice using gRNA and CAS9 endonuclease. Nucleic Acids Res. 2013 Aug 30.	Expresses CAS9 nuclease in mammalian cells. Used to modify genome of mouse embroys pCAGGS
M-SPcas	Cas9 (Other)	CMV	Neomycin (select with G418)	Church	Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.	Mammalian S. pyogenes Cas9 expression, human optimized pcDNA3.3 TOPO
M-ST1cas	Cas9 (Other)	CMV	Neomycin (select with G418)	Church	Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.	Mammalian S. thermophilus #1 Cas9 expression, human optimized pcDNA3.3 TOPO
M-NMcas	Cas9 (Other)	CMV	Neomycin (select with G418)	Church	Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.	Mammalian N. meningitidis Cas9 expression, human optimized pcDNA3.3 hygro
pCW-Cas9	humanized S. pyogenes Cas9	Tet ON	Puromycin	Sabatini	Genetic screens in human cells using the CRISPR-Cas9 system. Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12.	Doxycycline-inducible lentiviral expression of SpCas9 pCW57.1
pCAG-hCas9	hCas9	CAG	Neomycin (select with G418)	Hatada	Generation of an ICF syndrome model by efficient genome editing of human induced pluripotent stem cells using the CRISPR system. Int J Mol Sci. 2013 Sep 30;14(10):19774-81. doi: 10.3390/ijms141019774.	Expresses hCas9 under the CAG promoter for CRISPR pEGFP-N1
lentiCRISPR v2	Cas9 (Synthetic), Puromycin resistance	EFS-NS, EFS-NS	Puromycin	Zhang	Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047.	Replaces original lentiCRISPRv1 (Addgene Plasmid 49535) and produces ~10-fold higher titer virus. 3rd generation lentiviral backbone. Custom
lentiCas9-Blast	Cas9 (Synthetic), Blasticidin resistance	EFS-NS, EFS-NS	Blasticidin	Zhang	Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047.	Expresses human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance from EFS promoter. 3rd generation lentiviral backbone. pFUGW
pLenti-OC-IRES-BSD	OCT1 (Homo sapiens), Cas9 (Other)	CMV	Blasticidin	Wei	High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 2014 Apr 9. doi: 10.1038/nature13166.	To create stable cell clones with high-level expression of Cas9 and OCT1 pLenti-CMV-BSD POU2F1 OCT1, OTF1, oct-1B
pLV hUbC-Cas9-T2A-GFP	humanized Cas9 T2A GFP (Other)	hUbC		Gersbach	Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 2014 Aug 13. pii: gku749.	3rd generation transfer vector. Co-expresses human optimized S. pyogenes Cas9 and GFP FUGW
pSQT834	Csy4-T2A-Cas9-NLS (Homo sapiens)	CAG		Joung	Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.	Csy4 and Cas9 nuclease expression plasmid pCAG-CFP
pSQT817	Cas9	CAG		Joung	Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.	wildtype Cas9 expression plasmid pCAG-CFP
pL-CRISPR.EFS.GFP	SpCas9 (Other), Sp sgRNA scaffold, EFS (Homo sapiens), P2A-eGFP (Synthetic)	EFS, hU6		Ebert	Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951.	Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. EFS Promoter driven pLKO.005
pL-CRISPR.EFS.tRFP	SpCas9 (Other), Sp sgRNA scaffold, EFS (Homo sapiens), P2A-tRFP (Synthetic)			Ebert	Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951.	Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. EFS Promoter driven pLKO.005
pLKO5d.EFS.SpCas9.P2A.BSD	SpCas9 (Other), EFS (Homo sapiens), P2A-BSD (Synthetic)		Blasticidin	Ebert	Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951.	Lentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter driven pLKO.005
pL-CRISPR.SFFV.tRFP	SpCas9 (Other), Sp sgRNA scaffold, SFFV (Synthetic), P2A-tRFP (Synthetic)			Ebert	Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951.	Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter driven pLKO.005
pL-CRISPR.SFFV.GFP	SpCas9 (Other), Sp sgRNA scaffold, SFFV (Synthetic), P2A-eGFP (Synthetic)			Ebert	Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951.	Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter driven pLKO.005
pL-CRISPR.EFS.PAC	SpCas9 (Other), Sp sgRNA scaffold, EFS (Homo sapiens), P2A-PAC (Synthetic)		Puromycin	Ebert	Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951.	Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, EFS Promoter driven pLKO.005
pL-CRISPR.SFFV.PAC	SpCas9 (Other), Sp sgRNA scaffold, SFFV (Synthetic), P2A-PAC (Synthetic)		Puromycin	Ebert	Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951.	Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, SFFV Promoter driven pLKO.005
pAdSh.PGK.Cas9	Human codon-optimized S. pyogenes Cas9 (Synthetic)		Neomycin (select with G418)	Goncalves	Adenoviral vector delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi: 10.1038/srep05105.	Expresses human codon-optimized S. pyogenes Cas9 from the human PGK-1 gene promoter pBR322-based pAdEasy backbone
pLKO5d.EFS.SpCas9.P2A.PAC	SpCas9 (Other), EFS (Homo sapiens), P2A-PAC (Synthetic)		Puromycin	Ebert	Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951.	Lentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter driven pLKO.005
Puro-Cas9 donor	hSpCas9 (Other)		Puromycin	Huangfu	An iCRISPR Platform for Rapid, Multiplexable, and Inducible Genome Editing in Human Pluripotent Stem Cells. Cell Stem Cell. 2014 Jun 11. pii: S1934-5909(14)00205-7. doi: 10.1016/j.stem.2014.05.018.	Donor vector for genomic targeting of a Tetracycline-inducible Cas9 cassette to the human AAVS1/PPP1R12C locus N/A
pX330A-1x2	humanized S. pyogenes Cas9 nuclease (Other)	CBh		Yamamoto	Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.	Expresses Cas9 nuclease and gRNA pUC ori vector
piCRg Entry	hSpCas9			Huangfu	An iCRISPR Platform for Rapid, Multiplexable, and Inducible Genome Editing in Human Pluripotent Stem Cells. Cell Stem Cell. 2014 Jun 11. pii: S1934-5909(14)00205-7. doi: 10.1016/j.stem.2014.05.018.	Cas9/gRNA Entry expression plasmid Low copy
pCAG-T3-hCASeGFP-pA	CAS9 (Synthetic)	CAG		Fujii	Efficient generation of large-scale genome-modified mice using gRNA and CAS9 endonuclease. Nucleic Acids Res. 2013 Aug 30.	Expresses CAS9-eGFP fusion protein in mammalian cells. pCAGGS
Eef1a-1955/-1>nls::Cas9::nls	nls::Cas9::nls (Other)	Ciinte.Eef1a (EF1alpha) -1955/-1		Christiaen	Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488.	Eef1a (EF1alpha) promoter driving nls::Cas9::nls pCESAx
Mesp-1916/-1>nls::Cas9::nls	nls::Cas9::nls (Other)	Ciinte.Mesp -1916/-1		Christiaen	Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488.	Mesp driver driving nls::Cas9::nls pCESAx
Sox1/2/3-2373/+3>nls::Cas9::nls	nls::Cas9::nls (Other)	Ciinte.Sox1/2/3 (SoxB1) -2373/+3		Christiaen	Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488.	Sox1/2/3 (SoxB1) driver driving nls::Cas9::nls pCESAx
pHL-EF1a-SphcCas9-iP-A	CRISPR Cas9 (Other)		Puromycin	Hotta	Precise Correction of the Dystrophin Gene in Duchenne Muscular Dystrophy Patient Induced Pluripotent Stem Cells by TALEN and CRISPR-Cas9. Stem Cell Reports. 2014 Nov 25. pii: S2213-6711(14)00335-X. doi: 10.1016/j.stemcr.2014.10.013.	Expresses human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene. pHL-EF1a-GW-iP-A
pSECC	Cas9 (Other), Cre	EFS, EFS (after Cas9-2A)		Jacks	Rapid modelling of cooperating genetic events in cancer through somatic genome editing. Nature. 2014 Oct 22. doi: 10.1038/nature13906.	3rd generation vector. Expresses a sgRNA of interest, Cas9 and Cre pLL3.3
PX551	SpCas9 (Synthetic)	pMecp2		Zhang	In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nat Biotechnol. 2014 Oct 19. doi: 10.1038/nbt.3055.	pAAV-pMecp2-SpCas9-spA (AAV-SpCas9). AAV plasmid expressing Cas9 in neurons under control of truncated mecp2 promoter. pAAV
LSL-Cas9-Rosa26TV	Cas9 (Synthetic), EGFP	CAG, CAG	Neomycin (select with G418) ; DTA	Zhang	CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.	Cre-dependent Cas9 expression plasmid and targeting vector for the mouse Rosa26 locus. Cas9 expression is Cre-dependent and the targeting vector has positive (Neo) and negative (DTA) selection. Ai9
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA	hSaCas9 (Other), Chimeric guide for SaCas9 (Other)			Zhang	In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015 Apr 1. doi: 10.1038/nature14299.	A single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA. pAAV
pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA	hSaCas9 (Other)			Zhang	In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015 Apr 1. doi: 10.1038/nature14299.	A human codon-optimized Cas9 from Staphylococcus aureus (SaCas9). pAAV
pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNA	hSaCas9 (Other), Chimeric guide for SaCas9 (Other)			Zhang	In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015 Apr 1. doi: 10.1038/nature14299.	A single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA. pAAV
pMuLE ENTR CMV-hCas9 R4-R3	human codon optimized Cas9 (Synthetic)	CMV		Frew	A versatile modular vector system for rapid combinatorial mammalian genetics. J Clin Invest. 2015 Mar 9. pii: 79743. doi: 10.1172/JCI79743.	MuLE (Multiple Lentiviral Expression) Entry vector containing CMV promoter and human codon optimized Cas9 module Compatible with MultiSite Gateway cloning N/A
pMuLE ENTR SV40-hCas9 L3-L2	human codon optimized Cas9 (Synthetic)	SV40		Frew	A versatile modular vector system for rapid combinatorial mammalian genetics. J Clin Invest. 2015 Mar 9. pii: 79743. doi: 10.1172/JCI79743.	MuLE (Multiple Lentiviral Expression) Entry vector containing SV40 promoter and human codon optimized Cas9 module. Compatible with MultiSite Gateway cloning N/A
pMuLE ENTR SV40-hCas9 L5-L2	human codon optimized Cas9 (Synthetic)	SV40		Frew	A versatile modular vector system for rapid combinatorial mammalian genetics. J Clin Invest. 2015 Mar 9. pii: 79743. doi: 10.1172/JCI79743.	MuLE (Multiple Lentiviral Expression) Entry vector containing SV40 promoter and human codon optimized Cas9 module. Compatible with MultiSite Gateway cloning N/A
c3GIC9	humanized S. Pyogenes Cas9 (Other)	TRE3G		Dow	Inducible in vivo genome editing with CRISPR-Cas9. Nat Biotechnol. 2015 Apr;33(4):390-4. doi: 10.1038/nbt.3155. Epub 2015 Feb 18.	col1a1 targeting vector for inducible [TRE3G]-GFP-IRES-Cas9 expression. Contains NsiI cloning site for U6-sgRNA cassettes col1a1 Flp-in targeting construct
ptreCas9-mKate2ps-T1gRNA	Cas9–mKate2ps (Synthetic)			Bleris	CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18.	Inducible; gRNA seq is ATGAGAATCAAGGCGGTCGA pTag-CFP
pCas9–mKate2ps–EgRNA	Cas9–mKate2ps (Synthetic)			Bleris	CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18.	Empty; no U6 gRNA cassette pTag-CFP
pCas9–mKate2ps–T1gRNA	Cas9–mKate2ps (Synthetic)			Bleris	CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18.	t1 gRNA (ATGAGAATCAAGGCGGTCGA) pTag-CFP
PX851	SpCas9 (aa 2-535)	CBh		Zhang	A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149.	N-term SpCas9 piece of inducible split-4 (Cas9(N)-FRB-NES split-4). PX330
PX852	SpCas9 (aa536-1368)	CBh		Zhang	A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149.	C-term SpCas9 piece of inducible split-4 (Cas9(C)-FKBP split-4). PX330
PX853	SpCas9 (aa 2-573)	CBh		Zhang	A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149.	N-term SpCas9 piece of inducible split-5 (Cas9(N)-FRB-NES split-5). PX330
PX854	SpCas9 (aa573-1368)	CBh		Zhang	A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149.	C-term SpCas9 piece of inducible split-5 (Cas9(C)-FKBP split-5). PX330
pLSC-5	SpCas9(574-1368), SpCas9(2-573)	EFS, EFS	Puromycin	Zhang	A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149.	Lenti vector for expression of inducible split Cas9 lentiCRISPR
pSpCas9(BB)-2A-Puro (PX459) V2.0	hSpCas9-2A-Puro V2.0 (Synthetic)	Cbh	Puromycin	Zhang	Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24.	Cas9 from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0) PX459
lentiCas9-EGFP	Cas9 (Synthetic), EGFP (Other)	EFS-NS, EFS-NS		Zhang	Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis. Cell. 2015 Mar 12;160(6):1246-60. doi: 10.1016/j.cell.2015.02.038. Epub 2015 Mar 5.	Expresses human codon-optimized S. pyogenes Cas9 protein and EGFP from EFS promoter. 3rd generation lentiviral backbone. pFUGW
pX330S-2-PITCh	humanized S. pyogenes Cas9 (Other)	CBh		Yamamoto	MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc. 2016 Jan;11(1):118-33. doi: 10.1038/nprot.2015.140. Epub 2015 Dec 17.	Expresses Cas9 nuclease and the PITCh-gRNA pUC ori vector
pX330A-FBL/PITCh	humanized S. pyogenes Cas9 (Other)	CBh		Yamamoto	MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc. 2016 Jan;11(1):118-33. doi: 10.1038/nprot.2015.140. Epub 2015 Dec 17.	Expresses Cas9 nuclease, FBL-specific gRNA, and the PITCh-gRNA pUC ori vector
Adeno Cas9		U6 and CBh		Ventura	In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014 Dec 18;516(7531):423-7. doi: 10.1038/nature13902. Epub 2014 Oct 22.	Adenoviral vector for the expression of the Cas9 pacAd5 Tag / Fusion Protein FLAG
pX333		CBh; U6		Ventura	In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014 Dec 18;516(7531):423-7. doi: 10.1038/nature13902. Epub 2014 Oct 22.	Vector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter. pX333 Tag / Fusion Protein 3XFLAG-Cas9 (N terminal on backbone)
pKMD106e - intein-Cas9(S219)	mammalian codon-optimized S. pyogenes intein-Cas9(S219) - NLS - 3x FLAG (Other)	CMV		Liu	Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol. 2015 May;11(5):316-8. doi: 10.1038/nchembio.1793. Epub 2015 Apr 6.	Expresses intein-Cas9(S219) in mammalian cells pJDS246
pKMD106h - intein-Cas9(C574)	mammalian codon-optimized S. pyogenes intein-Cas9(C574) - NLS - 3x FLAG (Other)	CMV		Liu	Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol. 2015 May;11(5):316-8. doi: 10.1038/nchembio.1793. Epub 2015 Apr 6.	Expresses intein-Cas9(C574) in mammalian cells pJDS246
pKMD111e - intein-Cas9(S219-G521R)	mammalian codon-optimized S. pyogenes intein-Cas9(S219-G521R) - NLS - 3x FLAG (Other)	CMV		Liu	Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol. 2015 May;11(5):316-8. doi: 10.1038/nchembio.1793. Epub 2015 Apr 6.	Expresses intein-Cas9(S219-G521R) in mammalian cells pJDS246
pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI)	Cas9 (Other), hU6 promoter; BbsI sites for sgRNA, H1 promoter; BamHI site for shRNA	CBh, U6, H1		Kuehn	Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.	Expression vector for sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry via T2A pU6-(BbsI)_CBh-Cas9-T2A-BFP
pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B	Cas9 (Other), sgRNA cassette	CBh, U6		Kuehn	Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.	Expression vector for sgRNA and for Expression of Cas9 linked to BFP via T2A linked to Ad4 E1B via P2A pU6-(BbsI)_CBh-Cas9-T2A-BFP
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1B	Cas9 (Other), sgRNA targeting ROSA26-1	CBh, U6		Kuehn	Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.	Expression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2A pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6	Cas9 (Other), sgRNA cassette	CBh, U6		Kuehn	Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.	Expression vector for sgRNA and Cas9 linked via T2A to BFP linked to the Ad4 E4orf6 gene via P2A pU6-(BbsI)_CBh-Cas9-T2A-BFP
pU6-(BbsI)_CBh-Cas9-T2A-mcherry-P2A-Ad4E1B	Cas9 (Other), sgRNA cassette	CBh, U6		Kuehn	Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.	Expression vector for sgRNA and for Expression of Cas9 linked via T2A to mCherry and to Ad4 E1B55K via P2A pU6-(BbsI)_CBh-Cas9-T2A-mCherry
pU6-(BbsI)_CBh-Cas9-T2A-mcherry-P2A-Ad4E4orf6	Cas9 (Other), sgRNA cassette	CBh, U6		Kuehn	Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.	Expression vector for sgRNA and for Expression of Cas9 linked via T2A to mCherry linked to the Ad4 E4orf6 gene via P2A pU6-(BbsI)_CBh-Cas9-T2A-mCherry
pU6-(BbsI)_CBh-Cas9-T2A-BFP	Cas9 (Other), sgRNA cassette	CBh, U6		Kuehn	Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.	Expression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to BFP via a T2A peptide pX330
pU6-(BbsI)_CBh-Cas9-T2A-mCherry	Cas9 (Other), sgRNA cassette	CBh, U6		Kuehn	Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.	Expression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to mCherry via a T2A peptide pX330
pMCS-rybozyme-IRES-CAS9	CAS9 (Synthetic), HDV ribozyme (Other)			Fujii	Development of a mono-promoter-driven CRISPR/Cas9 system in mammalian cells. Sci Rep. 2015 Dec 16;5:18341. doi: 10.1038/srep18341.	Plasmid encoding multiple cloning site, rybozyme and IRES-CAS9. pCAGGS
pSaCas9_GFP	SaCas9-2A-GFP (Synthetic)	CAG		Musunuru	Staphylococcus aureus Cas9 (unpublished)	Co-expression of human codon-optimized Staphylococcus aureus Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells and other mammalian cells pCAG
pCas9–mKate2ps–CgRNA	Cas9–mKate2ps			Bleris	CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18.	Control gRNA (GTCAAGGCACTCTTGCCTA) pTag-CFP
MSCV_Cas9_puro	Cas9 (Synthetic)	MSSV_LTR	Puromycin	Vakoc	Discovery of cancer drug targets by CRISPR-Cas9 screening of protein domains. Nat Biotechnol. 2015 May 11. doi: 10.1038/nbt.3235.	Retroviral introduction of Cas9 into mammalian cell line. MSCV_puro
MSP469	mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/R1335Q/T1337R)-NLS-3XFlag (Other)	CMV & T7		Joung	Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592.	Human expression vector for SpCas9 VQR variant: CMV-T7-humanSpCas9(D1135V/R1335Q/T1337R)-NLS-3xFLAG (VQR variant) JDS246 Tags / Fusion Proteins NLS (C terminal on insert) 3x FLAG (C terminal on insert)
MSP680	mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E/R1335Q/T1337R)-NLS-3XFlag (Other)	CMV & T7		Joung	Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592.	Human expression vector for SpCas9 EQR variant: CMV-T7-humanSpCas9(D1135E/R1335Q/T1337R)-NLS-3xFLAG (EQR variant) JDS246 Tags / Fusion Proteins NLS (C terminal on insert) 3x FLAG (C terminal on insert)
MSP1101	mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag (Other)	CMV & T7		Joung	Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592.	Human expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant) JDS246 Tags / Fusion Proteins NLS (C terminal on insert) 3x FLAG (C terminal on insert)
MSP977	mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E)-NLS-3XFlag (Other)	CMV & T7		Joung	Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592.	Human expression vector for SpCas9 D1135E variant: CMV-T7-humanSpCas9(D1135E)-NLS-3xFLAG JDS246 Tags / Fusion Proteins NLS (C terminal on insert) 3x FLAG (C terminal on insert)
MSP1594	mammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS (Other)	CAG		Joung	Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592.	Human expression vector for S. thermophilus 1 Cas9: CAG-humanSt1Cas9-NLS pCAG-CFP Tag / Fusion Protein NLS (C terminal on insert)
BPK2139	mammalian codon-optimized Staphylococcus aureus Cas9-NLS-3xFlag (Other)	CAG		Joung	Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592.	Human expression vector for S .aureus Cas9: CAG-humanSaCas9-NLS-3xFLAG pCAG-CFP Tags / Fusion Proteins NLS (C terminal on insert) 3x FLAG (C terminal on insert)
pBGK	Cas9			Ohtsuka	Mouse Genome Editing Using the CRISPR/Cas System. Curr Protoc Hum Genet. 2014 Oct 1;83:15.7.1-15.7.27. doi: 10.1002/0471142905.hg1507s83.	Vector for Cas9 mRNA synthesis pcDNA3.1
pCAS9-mCherry-Frame +0	gRNA frame +0			Hornung	CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.	CRISPaint frame selector +0 pCAS9-mCherry
pCAS9-mCherry-Frame +1	gRNA frame +1			Hornung	CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.	CRISPaint frame selector +1 pCAS9-mCherry
pCAS9-mCherry-Frame +2	gRNA frame +2			Hornung	CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.	CRISPaint frame selector +2 pCAS9-mCherry
pCAS9-mCherry-TUBB	gRNA TUBB			Hornung	CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.	CRISPaint target selector TUBB pCAS9-mCherry
pCAS9-mCherry-ACTG1	gRNA ACTG1 (Homo sapiens)			Hornung	CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.	CRISPaint target selector ACTG1 pCAS9-mCherry
pCAS9-mCherry-HIST1H4C	gRNA HIST1H4C (Homo sapiens)			Hornung	CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.	CRISPaint target selector HIST1H4C pCAS9-mCherry
pKLV2-EF1a-BsdCas9-W	EF1a-Cas9 cassette, WPRE (Homo sapiens)	EF1a		Yusa	A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079.	Lentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the N-terminus pKLV2 lentiviral vector
pKLV2-U6gRNA5(Empty)-PGKGFP2ABFP-W	U6gRNA cassette, PGKGFP2ABFP cassette, WPRE (Homo sapiens)			Yusa	A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079.	Cas9 activity reporter (control) with GFP and BFP pKLV2 lentiviral vector
pRosa26-EF1a-hCas9IRESneo	EF1a-hCas9IRESneopA (Synthetic)			Yusa	A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079.	Mouse Rosa26 targeting vector carrying the EF1a-hCas9-IRES-neo cassette pBluescriptII
phumanCas9 (GB0575)	Cas9 coding region (human codon optimised) (Other)			Orzaez	GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiol. 2013 Jul;162(3):1618-31.	Provides the human codon optimized CDS of Cas9 protein as a level 0 GoldenBraid part pUPD
PX377 Corynebacter diphtheriae Cas9	CdCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Corynebacter diphtheriae Cas9 pDREAM
PX378 Sutterella wadsworthensis Cas9	SwCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Sutterella wadsworthensis Cas9 pDREAM
PX379 Legionella pneumophila str. Paris Cas9	LpCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Legionella pneumophila str. Paris Cas9 pDREAM
PX380 Treponema denticola Cas9	TdCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Treponema denticola Cas9 pDREAM
PX381 Filifactor alocis Cas9	FaCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Filifactor alocis Cas9 pDREAM
PX382 Staphylococcus pseudintermedius Cas9	SpsCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Staphylococcus pseudintermedius Cas9 pDREAM
PX383 Lactobacillus johnsonii Cas9	LjCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Lactobacillus johnsonii Cas9 pDREAM
PX385 Streptococcus pasteurianus Cas9	SpaCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Streptococcus pasteurianus Cas9 pDREAM
PX386 Lactobacillus farciminis Cas9	LfCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Lactobacillus farciminis Cas9 pDREAM
PX387 Mycoplasma mobile Cas9	MmCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Mycoplasma mobile Cas9 pDREAM
PX388 Bacteroides coprophilus Cas9	BcCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Bacteroides coprophilus Cas9 pDREAM
PX389 Fluviicola taffensis Cas9	FtCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Fluviicola taffensis Cas9 pDREAM
PX390 Flavobacterium columnare Cas9	FcCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Flavobacterium columnare Cas9 pDREAM
PX391 Sphaerochaeta globus str. Buddy Cas9	SgCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Sphaerochaeta globus str. Buddy Cas9 pDREAM
PX392 Azospirillum B510 Cas9	AzoCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Azospirillum B510 Cas9 pDREAM
PX393 Gluconacetobacter diazotrophicus Cas9	GdCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Gluconacetobacter diazotrophicus Cas9 pDREAM
PX394 Neisseria cinerea Cas9	NcCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Neisseria cinerea Cas9 pDREAM
PX395 Roseburia intestinalis Cas9	RiCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Roseburia intestinalis Cas9 pDREAM
PX396 Parvibaculum lavamentivorans Cas9	PlCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Parvibaculum lavamentivorans Cas9 pDREAM
PX398 Nitratifractor salsuginis str DSM 16511 Cas9	NsCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Nitratifractor salsuginis str DSM 16511 Cas9 pDREAM
PX399 Mycoplasma gallisepticum str. F Cas9	MgCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Mycoplasma gallisepticum str. F Cas9 pDREAM
PX400 Campylobacter lari CF89-12 Cas9	ClCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Campylobacter lari CF89-12 Cas9 pDREAM
PX403 Streptococcus thermophilus LMD-9 CRISPR 3 Cas9	St3Cas9 (Synthetic)	CBh		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Streptococcus thermophilus LMD-9 CRISPR 3 Cas9 Unknown
PX404 Campylobacter jejuni Cas9	CjCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Campylobacter jejuni Cas9 Unknown
pKLV2-EF1a-Cas9Bsd-W	EF1a-Cas9 cassette, WPRE (Homo sapiens)	EF1a		Yusa	A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079.	Lentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the C-terminus pKLV2 lentiviral vector
LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR	puromycin (Synthetic), hCas9 (Synthetic)	CAG, CAG	Puromycin	Elverløv-Jakobsen	Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)	A Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expression Amp
px330_SMAD exon 9 gRNA	SMAD exon 9 gRNA (Synthetic)	U6		Elverløv-Jakobsen	Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)	px330 with gRNA towards SMAD exon 9. Cas9 is expressed from a CAG promoter. amp
CAS9PBKS	Cas9 (Other)	CbAkt		Bennett	Genome editing using FACS enrichment of nuclease-expressing cells and indel detection by amplicon analysis. Nat Protoc. 2017 Mar;12(3):581-603. doi: 10.1038/nprot.2016.165. Epub 2017 Feb 16.	CbAkt promoter driven Cas9-2A-GFP (from px458) pBKS
Cas9-2A-Cre	Cas9 and Cre recombinase (Homo sapiens)	CAG		Zhang	Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001.	co-expressing Cas9 and Cre recombinase Cas9-2A-GFP
PX405 Neisseria meningitidis Cas9	NmCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Neisseria meningitidis Cas9 pDREAM
PX406 Pasteurella multocida Cas9	PmCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Pasteurella multocida Cas9 pDREAM
PX408 Francisella tularensis subsp. novicida Cas9	FtCas9 (Synthetic)	CMV		Zhang	Feng Zhang lab bacterial Cas9 orthologs (unpublished)	Francisella tularensis subsp. novicida Cas9 pDREAM
pCSDest2-SpCas9-NLS-3XHA-NLS-Zif268	Zif268 (Mus musculus)			Wolfe	DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.	Expresses wild type SpCas9 fused to Zif268 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS Egr1 A530045N19Rik, ETR103, Egr-1, Krox-1, Krox-24, Krox24, NGF1-A, NGFI-A, NGFIA, TIS8, Zenk, Zfp-6, Zif268, egr
pCSDest2-SpCas9-NLS-3XHA-NLS	SpCas9 (Other)			Wolfe	DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.	Expresses wild type SpCas9 in mammalian cells pCSDest2
pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS2	TS2 ZFP (Synthetic)			Wolfe	DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.	Expresses wild type SpCas9 fused to ZFP-TS2 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS
pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS3	TS3 ZFP (Synthetic)			Wolfe	DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.	Expresses wild type SpCas9 fused to ZFP-TS3 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS
pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS4	TS4 ZFP (Synthetic)			Wolfe	DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.	Expresses wild type SpCas9 fused to ZFP-TS4 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS
pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-ZFP_TS3	TS3 ZFP (Synthetic)			Wolfe	DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.	Expresses R1335K mutant SpCas9 fused to ZFP-TS3 in mammalian cell pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-Zif268
pY004 (pcDNA3.1-hFnCpf1)	hFnCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized FnCpf1 pcDNA3.1
pY005 (pcDNA3.1-hLb3Cpf1)	hLb3Cpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized Lb3Cpf1 pcDNA3.1
pY006 (pcDNA3.1-hBpCpf1)	hBpCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized BpCpf1 pcDNA3.1
pY007 (pcDNA3.1-hPeCpf1)	hPeCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized PeCpf1 pcDNA3.1
pY008 (pcDNA3.1-hPbCpf1)	hPbCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized LPbCpf1 pcDNA3.1
pY009 (pcDNA3.1-hSsCpf1)	hSsCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized SsCpf1 pcDNA3.1
pY010 (pcDNA3.1-hAsCpf1)	hAsCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized AsCpf1 pcDNA3.1
pY011 (pcDNA3.1-hLb2Cpf1)	hLb2Cpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized Lb2Cpf1 pcDNA3.1
pY012 (pcDNA3.1-hCMtCpf1)	hCMtCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized CMtCpf1 pcDNA3.1
pY013 (pcDNA3.1-hEeCpf1)	hEeCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized EeCpf1 pcDNA3.1
pY014 (pcDNA3.1-hMbCpf1)	hMbCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized MbCpf1 pcDNA3.1
pY015 (pcDNA3.1-hLiCpf1)	hLiCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized LiCpf1 pcDNA3.1
pY016 (pcDNA3.1-hLbCpf1)	hLbCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized LbCpf1 pcDNA3.1
pY017 (pcDNA3.1-hPcCpf1)	hPcCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized PcCpf1 pcDNA3.1
pY018 (pcDNA3.1-hPdCpf1)	hPdCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized PdCpf1 pcDNA3.1
pY019 (pcDNA3.1-hPmCpf1)	hPmCpf1 (Other)	CMV	Neomycin (select with G418)	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Expresses humanized PmCpf1 pcDNA3.1
FUCas9Cherry	humanised S.pyogenes cas9 (Other)	hUbC		Herold	An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26.	Expresses Cas9 with fluorescent Cherry reporter FUGW
lentiCas9-Venus	Cas9 (Synthetic), Venus Reporter (Synthetic)	EFS-NS, P2A	Venus	Bauer	BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature. 2015 Sep 16. doi: 10.1038/nature15521.	Expresses human codon-optimized S. pyogenes Cas9 protein and Venus reporter from EFS promoter. Lentiviral backbone. pFUGW
MSP1830	mammalian codon-optimized KKH variant Staphylococcus aureus Cas9(E782K/N968K/R1015H)-NLS-3xFlag (Other)	CAG		Joung	Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. 2015 Nov 2. doi: 10.1038/nbt.3404.	Human expression plasmid for SaCas9 KKH variant: CAG-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG pCAG-CFP
spCas9-BlastR (pCBhCas9-BlastR)	spCas9	CBh	Blasticidin	Sherwood	Cloning-free CRISPR. Stem Cell Reports. 2015 Oct 27. pii: S2213-6711(15)00284-2. doi: 10.1016/j.stemcr.2015.09.022.	Expresses SpCas9 and Blasticidin resistance p2Tol2
pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)	humanized S. pyogenes Cas9 fused to human Geminin (Homo sapiens)	CBh		Draetta	Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair. Cell Rep. 2016 Feb 3. pii: S2211-1247(16)00040-1. doi: 10.1016/j.celrep.2016.01.019.	A human codon-optimized SpCas9 fused to first 110 amino acids of human GEMININ and chimeric guide RNA expression plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 GMNN Gem, MGORS6
eSpCas9(1.1)	enhanced specificity Cas9 (1.1) (Other)	CBh		Zhang	Rationally engineered Cas9 nucleases with improved specificity. Science. 2015 Dec 1. pii: aad5227.	Expresses high specificity SpCas9. Px330-like plasmid. pX330-U6-Chimeric_BB-CBh-hSpCas9
pCR1002	T7pr_10xHis-MBP-TEV-SPyCas9			Corn	Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 2016 Jan 20. doi: 10.1038/nbt.3481.	Express Streptococcus pyogenes Cas9 SPynCas9
VP12	mammalian codon-optimized Streptococcus pyogenes Cas9 HF1(N497A/R661A/Q695A/Q926A)-NLS-3xFlag (Other)	CMV		Joung	High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526.	Human expression plasmid for SpCas9-HF1 variant: CMV-T7-humanSpCas9-HF1(N497A, R661A, Q695A, Q926A)-NLS-3xFLAG JDS246
MSP2135	mammalian codon-optimized Streptococcus pyogenes Cas9 HF2(N497A/R661A/Q695A/Q926A/D1135E)-NLS-3xFlag (Other)	CMV		Joung	High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526.	Human expression plasmid for SpCas9-HF2 variant: CMV-T7-humanSpCas9-HF2(N497A, R661A, Q695A, Q926A, D1135E)-NLS-3xFLAG JDS246
MSP2133	mammalian codon-optimized Streptococcus pyogenes Cas9 HF4(Y450A/N497A/R661A/Q695A/Q926A)-NLS-3xFlag (Other)	CMV		Joung	High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526.	Human expression plasmid for SpCas9-HF4 variant: CMV-T7-humanSpCas9-HF4(Y450A, N497A, R661A, Q695A, Q926A)-NLS-3xFLAG JDS246
MSP2440	mammalian codon-optimized Streptococcus pyogenes Cas9 VQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/R1335Q/T1337R)-NLS-3xFlag (Other)	CMV		Joung	High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526.	Human expression plasmid for SpCas9-VQR-HF1 variant: CMV-T7-humanSpCas9-VQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, R1335Q, T1337R)-NLS-3xFLAG JDS246
BPK2797	mammalian codon-optimized Streptococcus pyogenes Cas9 VRQR(D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag (Other)	CMV		Joung	High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526.	Human expression plasmid for SpCas9-VRQR variant: CMV-T7-humanSpCas9-VRQR(D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAG JDS246
MSP2443	mammalian codon-optimized Streptococcus pyogenes Cas9 VRQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag (Other)	CMV		Joung	High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526.	Human expression plasmid for SpCas9-VRQR-HF1 variant: CMV-T7-humanSpCas9-VRQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAG JDS246
pCas9-polyA	Cas9-polyadenine (Other)	T7		Mashimo	ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 2016 Jan 20;7:10431. doi: 10.1038/ncomms10431.	express hCas9 byT7 promoter with polyadenine tails pcDNA3.3-TOPO
MSP2372	mammalian codon-optimized Streptococcus pyogenes Cas9 (R661A/Q695A/Q926A)-NLS-3xFlag (Other)	CMV		Joung	High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526.	Human expression plasmid for SpCas9(R661A/Q695A/Q926A) variant: CMV-T7-humanSpCas9(R661A, Q695A, Q926A)-NLS-3xFLAG JDS246
Lenti‐Cas9‐2A‐Blast	Cas9 (Synthetic)	EFS-NS	Blasticidin	Moffat	High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.	Lentiviral vector expressing human codon-optimized S. pyogenes FLAG-tagged Cas9 and blasticidin resistance from EFS promoter lenti CRISPR pXPR_001
pAAVS1-PDi-CRISPRn	Cas9 (Synthetic), rtTA (Synthetic)	TRE, CAG	Puromycin	Conklin	CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10.	Dox-inducible CRISPR nuclease (CRISPRn) knock in construct into the AAVS1 locus pAAVS1
pAWp30	EFSp-Cas9-P2A-Zeo			Lu	Multiplexed barcoded CRISPR-Cas9 screening enabled by CombiGEM. Proc Natl Acad Sci U S A. 2016 Feb 10. pii: 201517883.	pFUGW-EFSp-Cas9-P2A-Zeo pFUGW
pTE4396	As crRNA, AsCpf1	human U6, CMV	Neomycin (select with G418)	Welker	Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0.	Expresses human codon-optimized AsCpf1 and As crRNA. pcDNA3.1
pTE4398	Lb crRNA, LbCpf1	human U6, CMV	Neomycin (select with G418)	Welker	Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0.	Expresses human codon-optimized LbCpf1 and Lb crRNA. pcDNA3.1
pBLO1811_Cas9_noNLS_human	Cas9 (Homo sapiens)			Savage	Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528.	Human codon optimized plasmid to express Cas9 t2a mCherry w/o NLS and a sgRNA px330
pBLO1806_Cas9_2xNLS_human	Cas9 (Homo sapiens)			Savage	Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528.	Human codon optimized plasmid to express Cas9 t2a mCherry w/2xNLS and a sgRNA px330
pLentiCRISPR-EGFP				Bornhauser	Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.	Derived from LentiCRISPR v1 but expresses EGFP instead of puromycin resistance lentiCRISPRv1 Tag / Fusion Protein EGFP
pLentiCRISPR-tagBFP				Bornhauser	Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.	Derived from LentiCRISPR v1 but expresses tagBFP instead of puromycin resistance lentiCRISPRv1 Tag / Fusion Protein tagBFP
pLentiCRISPR-mCherry				Bornhauser	Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.	Derived from LentiCRISPR v1 but expresses mCherry instead of puromycin resistance. 3rd generation. lentiCRISPRv1 Tag / Fusion Protein mCherry
pLentiCRISPR-RFP657				Bornhauser	Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.	Derived from LentiCRISPR v1 but expresses RFP657 instead of puromycin resistance lentiCRISPRv1 Tag / Fusion Protein RFP657
FUG-T2A-Cas9	Cas9	Ubiquitin		Luikart	A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611.	Ubiquitin promoter expresses GFP and humanized spCas9 (from PX330) via a T2A motif. For cell transfection or use in lentiviral packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL. FUGW
pRubiC-T2A-Cas9	Cas9	Ubiquitin		Luikart	A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611.	Ubiquitin promoter expresses mCherry and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL. pRubi
pRubiG-T2A-Cas9	Cas9	Ubiquitin		Luikart	A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611.	Ubiquitin promoter expresses GFP and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL. pRubi
PXL	Cas9	U6		Luikart	A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611.	PX330 derived. Bbs1 & annealed oligos to insert guide strand. BstB1+Pac1 of PXL and FUX-/pRubiX- T2A-Cas9 for choice of sgRNA, viral backbone, and fluorescent protein. Pac1 to introduce 2nd sgRNA. PX330
pX330-BsaIx2-DD-Cas9	DD-SpCas9 (Other)	CAG		Calos	In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining. Nucleic Acids Res. 2016 Jan 13. pii: gkv1542.	Expresses DD-SpCas9 in mammalian cells and has a cloning site for an sgRNA. The FKBP12 L106P destabilization domain allows for inducible stabilization of Cas9 through the addition of Shield-1 modified pX330
pCas9-VRER_2A_GFP	Cas9-VRER (Synthetic)	CAG		Tessier-Lavigne	Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9. Nature. 2016 May 5;533(7601):125-9. doi: 10.1038/nature17664. Epub 2016 Apr 27.	Cas9 VRER variant that detects NGCG PAM, combined with 2A_GFP for expression control pCAG
pXPR_BRD111	Cas9		Blasticidin	Hahn	Integrated genetic and pharmacologic interrogation of rare cancers. NATURE COMMUNICATIONS 7:11987	Expresses Cas9 with the pLX311 backbone pLX311
CAG-Cas9-T2A-EGFP-ires-puro	WT SpCas9-T2A-EGFP-ires-puromycin resistance (Other)	CAG	Puromycin	Otonkoski	An Activating STAT3 Mutation Causes Neonatal Diabetes through Premature Induction of Pancreatic Differentiation Cell Reports 2017, 19: 281–294	Expresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter. PyCAG
pLentiCas9-T2A-BFP	T2A-BFP	In frame with Cas9	Blasticidin	Guigo	Scalable Design of Paired CRISPR Guide RNAs for Genomic Deletion. PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar.	Cas9 protein with BFP Lenti-Cas9-blast
pLentiCas9-T2A-GFP	T2A-GFP	In frame with Cas9	Blasticidin	Guigo	Scalable Design of Paired CRISPR Guide RNAs for Genomic Deletion. PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar.	Cas9 protein with GFP Lenti-Cas9-blast
pZac2.1 SV40-CMV-SaCas9-3xNLS	SV40-CMV-SaCas9-3xNLS (Synthetic)	SV40, CMV promoters		Wagers	In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31.	AAV vector containing SaCas9 pZac2.1
SQT1659	mammalian codon-optimized Acidaminococcus sp. BV3L6 Cpf1-NLS-3xHA (Other)	CAG		Joung	Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nat Biotechnol. 2016 Jun 27. doi: 10.1038/nbt.3620.	Human expression plasmid for AsCpf1-NLS-3xHA pCAG-GFP
SQT1665	mammalian codon-optimized Lachnospiraceae bacterium ND2006 Cpf1-NLS-3xHA (Other)	CAG		Joung	Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nat Biotechnol. 2016 Jun 27. doi: 10.1038/nbt.3620.	Human expression plasmid for LbCpf1-NLS-3xHA pCAG-GFP
pLentiCRISPR-E			Puromycin	Abbosh	LentiCRISPR version E (unpublished)	Introduce sgRNA into a lentiviral vector (LentiCRISPR V2) which contains eSpCas9 and puromycin cassette pLentiCRISPRV2 Tag / Fusion Protein Cas9-P2A-Puro
pCAG-SpCas9-GFP-U6-gRNA	SpCas9	CAG		Zou	pCAG-SpCas9-U6-gRNA (unpublished)	All-in-one CRISPR/Cas9 vector with CAG promoter for expression in human ESC/iPSC pSpCas9(BB)-2A-GFP (PX458)
pCAG-eCas9-GFP-U6-gRNA	eSpCas9(1.1)	CAG		Zou	pCAG-SpCas9-U6-gRNA (unpublished)	All-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in human pluripotent stem cells eSpCas9(1.1)
eSpCas9(1.1)_No_FLAG		CBh		Doyon	A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells. Cell Rep. 2015 Oct 7. pii: S2211-1247(15)01020-7. doi: 10.1016/j.celrep.2015.09.009.	FLAGless construct expressing high specificity eSpCas9(1.1). Px330-like plasmid. pX330-U6-Chimeric_BB-CBh-hSpCas9 Tag / Fusion Protein Untagged eSpCas9(1.1)
pTE4495	Mb crRNA (Other), MbCpf1	human U6, CMV	Neomycin (select with G418)	Welker	mammalian expression MbCpf1 nuclease and Mb crRNA (unpublished)	mammalian expression MbCpf1 nuclease and Mb crRNA pcDNA3.1
pTE4497	Fn crRNA (Other), FnCpf1	human U6, CMV	Neomycin (select with G418)	Welker	mammalian expression MbCpf1 nuclease and Mb crRNA (unpublished)	mammalian expression FnCpf1 nuclease and Fn crRNA pcDNA3.1
pDNR-SpCas9-Gem	SpCas9-Gem (Other)	T7		Little	A Cas9 Variant for Efficient Generation of Indel-Free Knockin or Gene-Corrected Human Pluripotent Stem Cells. Stem Cell Reports. 2016 Sep 13;7(3):508-17. doi: 10.1016/j.stemcr.2016.07.001. Epub 2016 Aug 4.	Used for in vitro transcription of SpCas9-Gem mRNA. Cas9 is fused to Geminin peptide and is degraded during G0/G1 phases of the cell-cycle to minimize indels caused by non-homologous end joining pDNR-Dual
pDNR-SpCas9	SpCas9 (Other)	T7		Little	A Cas9 Variant for Efficient Generation of Indel-Free Knockin or Gene-Corrected Human Pluripotent Stem Cells. Stem Cell Reports. 2016 Sep 13;7(3):508-17. doi: 10.1016/j.stemcr.2016.07.001. Epub 2016 Aug 4.	Used for in vitro transcription of SpCas9 mRNA. pDNR-Dual
pDNR-SpCas9-Cdt1	SpCas9-Cdt1 (Other)			Little	A Cas9 Variant for Efficient Generation of Indel-Free Knockin or Gene-Corrected Human Pluripotent Stem Cells. Stem Cell Reports. 2016 Sep 13;7(3):508-17. doi: 10.1016/j.stemcr.2016.07.001. Epub 2016 Aug 4.	Used for in vitro transcription of SpCas9-Cdt1 mRNA. Cas9 is fused to Cdt1 peptide and is degraded during S/G2 phases of the cell-cycle. pDNR-Dual
peSpCas9(1.1)-2×sgRNA (empty, donor)				Nakayama	Practical method for targeted disruption of cilia-related genes by using CRISPR/Cas9-mediated homology-independent knock-in system. Mol Biol Cell. 2017 Feb 8. pii: mbc.E17-01-0051. doi: 10.1091/mbc.E17-01-0051.	All-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains eSpCas9(1.1) and two sgRNA expression cassettes. The first gRNA cloning site is empty. eSpCas9(1.1)
pAAV-SMVP-Cas9N	Cas9N (Synthetic)			Church	A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.	Expresses Cas9N in mammalian cells. pZac2.1
pAAV-SMVP-Cas9C	Cas9C (Synthetic)			Church	A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.	Expresses Cas9C in mammalian cells. pZac2.1
pAAV-CASI-Cas9C	Cas9C (Synthetic)			Church	A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.	Expresses Cas9C in mammalian cells; derived from pZac2.1 with CASI promoter. pZac2.1
pSMVP-Cas9N	Cas9N (Synthetic)			Church	A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.	Plasmid that expresses Cas9N in mammalian cells. pMAX
pSMVP-Cas9C-P2A-turboGFP	Cas9C (Synthetic)			Church	A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.	Plasmid that expresses Cas9C in mammalian cells; co-expresses turboGFP. pMAX
pSMVP-Cas9C	Cas9C (Synthetic)			Church	A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.	Plasmid that expresses Cas9C in mammalian cells. pMAX
pSMVP-Cas9FL-P2A-turboGFP	Cas9FL (Synthetic)			Church	A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.	Plasmid that expresses Cas9FL in mammalian cells; co-expresses turboGFP. pMAX
pAAV-CASI-Cas9C-P2A-turboGFP	Cas9C (Synthetic)			Church	A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.	Expresses Cas9C in mammalian cells; co-expresses turboGFP. pZac2.1
pRZ-CAS9-mCherry	Cas9 (Synthetic)	CMV		Hornung	CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.	Cas9, mCherry expression pRZ
pCAS9-mCherry empty				Hornung	CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.	Cas9, mCherry, and sgRNA expression pCAS9
pCAS9-BFP empty				Hornung	CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.	Cas9, TagBFP, and sgRNA expression pCAS9
Construct 7 - CMVp-Cas9-3xNLS-HSVpA	Cas9-3xNLS (Homo sapiens)			Lu	Continuous genetic recording with self-targeting CRISPR-Cas in human cells. Science. 2016 Aug 18. pii: aag0511.	Expresses Cas9 fused to 3xNLS driven by CMV promoter. For mammalian cell expression pGL2-Luc (Addgene #26280)
Construct 12 - hUBCp_Cas9_3xNLS_p2a_puroR	Cas9-3xNLS (Homo sapiens)		Puromycin	Lu	Continuous genetic recording with self-targeting CRISPR-Cas in human cells. Science. 2016 Aug 18. pii: aag0511.	Lentiviral construct for building stable cell lines expressing Cas9 via puromycin selection Lentiviral
Construct 33 - NFKBRp_Cas9_3xNLS_p2a-puroR	Cas9-3xNLS		Puromycin	Lu	Continuous genetic recording with self-targeting CRISPR-Cas in human cells. Science. 2016 Aug 18. pii: aag0511.	Lentiviral construct for building stable cell lines expressing Cas9 in the presence of TNFa via puromycin selection Lentiviral
LentiCRISPRv2Cre	Cre Recombinase (Other)	EFS (P2A)		Feldser	Systematic in vivo inactivation of chromatin regulating enzymes identifies Setd2 as a potent tumor suppressor in lung adenocarcinoma. Cancer Res. 2017 Feb 15. pii: canres.2159.2016. doi: 10.1158/0008-5472.CAN-16-2159.	Lentiviral vector expressing Cre recombinase alongside Cas9 and an sgRNA cloning site lentiCRISPR v2 (Addgene #52961)
LentiCRISPRv2GFP	GFP (Other)	EFS (P2A)		Feldser	Systematic in vivo inactivation of chromatin regulating enzymes identifies Setd2 as a potent tumor suppressor in lung adenocarcinoma. Cancer Res. 2017 Feb 15. pii: canres.2159.2016. doi: 10.1158/0008-5472.CAN-16-2159.	Lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning site lentiCRISPR v2
lentiCRISPR v2-Blast	Blasticidin S deaminase	EF-1α	Blasticidin	Babu	CRISPR/Cas9-based system for loss-of-function screening (unpublished)	Mammalian expression of Cas9 and sgRNA scaffold lentiCRISPR v2 (#52961)
pCW-Cas9-Blast	SpCas9, Blasticidin S deaminase -T2A - reverse tetracycline-controlled transactivator	Tight Tre, human phosphoglycerate kinase 1 promoter	Blasticidin	Babu	CRISPR/Cas9-based system for loss-of-function screening (unpublished)	Lentiviral vector for mammalian expression of doxycycline-inducible Cas9 and constitutive expression of Blasticidin S deaminaase -T2A -rtTA pCW-Cas9 (#50661)
pLV-U6-gRNA-UbC-DsRed-P2A-Bsr	DsRed-Express2, Bsr	hUbC	Blasticidin	Gersbach	CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853.	Lentiviral SpCas9-gRNA expression vector with DsRed-Express2-P2A-BlastR FUGW
pLV-U6-gRNA-UbC-eGFP-P2A-Bsr	eGFP, Bsr	hUbC	Blasticidin	Gersbach	CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853.	Lentiviral SpCas9-gRNA expression vector with eGFP-P2A-BlastR FUGW
pPB-US-ECasE	ERT2-spCas9-ERT2 (Other)	U6 (gRNA), EF1a (ERT2-Cas9-ERT2)	Puromycin	Chen	Chen lab CRISPR plasmids (unpublished)	Piggyac transposon containing tamoxifen inducible Cas9 and a gRNA cassette. Piggybac Transposon
pCRISPR-S12	hSpCas9 (Other), eGFP (Other)	CMV, CMV (downstream of F2A self-cleaving peptide)	Puromycin, Hygromycin	Wu	An episomal CRISPR/Cas9 system to derive vector-free gene modified mammalian cells. Protein Cell. 2016 Sep;7(9):689-91. doi: 10.1007/s13238-016-0299-9.	To episomally express codon optimized Cas9 and chimeric guide RNA pCEP4
pX601-mCherry	mCherry	T2A		Kan	Genome editing using CRISPR-Cas9 to create the HPFH genotype in HSPCs: An approach for treating sickle cell disease and beta-thalassemia. Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6.	Staphylococcus aureus (SaCas9) conjugated with mCherry pX601
pX601-GFP	GFP (Other)			Kan	Genome editing using CRISPR-Cas9 to create the HPFH genotype in HSPCs: An approach for treating sickle cell disease and beta-thalassemia. Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6.	Staphylococcus aureus (SaCas9) conjugated with GFP pX601
iCas	Cas9 (Other)	CMV	OFP expression	Tan	A chemical-inducible CRISPR-Cas9 system for rapid control of genome editing. Nat Chem Biol. 2016 Sep 12. doi: 10.1038/nchembio.2179.	Expression of SpCas9 with 4 ERT2 fusion protein and empty gRNA cassette. The activity of Cas9 can be switched on and off in human cells with 4-hydroxytamoxifen (4-HT) GeneArt CRISPR Nuclease vector with OFP reporter
pY108 (lenti-AsCpf1)	huAsCpf1 (Synthetic), puromycin resistance gene (Synthetic)	EFS	Puromycin	Zhang	Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.	Lenti virus delivery of AsCpf1 and crRNA guide pHKO_23
pY109 (lenti-LbCpf1)	huLbCpf1 (Synthetic), puromycin resistance gene (Synthetic)	EFS	Puromycin	Zhang	Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.	Lenti virus delivery of LbCpf1 and crRNA guide pHKO_23
pY026	huAsCpf1 (Synthetic)	CMV		Zhang	Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.	Expresses huAsCpf1 and crRNA guide pcDNA3.1
pY027	huLbCpf1 (Synthetic)	CMV		Zhang	Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.	Expresses huLbCpf1 and crRNA guide pcDNA3.1
pY094	huAsCpf1 (Synthetic), GFP (Synthetic)	CMV		Zhang	Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.	Expresses huAsCpf1-T2A-GFP and crRNA guide pcDNA3.1
pY095	huLbCpf1 (Synthetic), GFP (Synthetic)	CMV		Zhang	Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.	Expresses huLbCpf1-T2A-GFP and crRNA guide pcDNA3.1
pY30	huAsCpf1 (Synthetic), puromycin resistance gene (Synthetic)	CMV	Puromycin	Zhang	Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.	Expresses huAsCpf1-P2A-puro and crRNA guide pcDNA3.1
pY31	huLbCpf1 (Synthetic), puromycin resistance gene (Synthetic)	CMV	Puromycin	Zhang	Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.	Expresses huLbCpf1-P2A-puro and crRNA guide pcDNA3.1
Lenti-AsCpf1-Blast	AsCpf1 (Other)	EFS-NS	Blasticidin	Kim	In vivo high-throughput profiling of CRISPR-Cpf1 activity. Nat Methods. 2016 Dec 19. doi: 10.1038/nmeth.4104.	Expresses human codon-optimized AsCpf1 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. lentiCas9-Blast(Addgene#:52962)
Lenti-LbCpf1-Blast	LbCpf1 (Other)	EFS-NS	Blasticidin	Kim	In vivo high-throughput profiling of CRISPR-Cpf1 activity. Nat Methods. 2016 Dec 19. doi: 10.1038/nmeth.4104.	Expresses human codon-optimized LbCpf1 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. lentiCas9-Blast(Addgene#:52962)
pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova)	loxP-stop-loxP (Other)			Iwasato	Supernova: A Versatile Vector System for Single-Cell Labeling and Gene Function Studies in vivo. Sci Rep. 2016 Oct 24;6:35747. doi: 10.1038/srep35747.	This plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9. pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene Plasmid #42230)
Lenti-iCas9-neo	Flag-iCas9-P2A-GFP (Other)		Neomycin (select with G418)	Yan	An easy and efficient inducible CRISPR/Cas9 platform with improved specificity for multiple gene targeting. Nucleic Acids Res. 2016 Nov 2;44(19):e149. Epub 2016 Jul 25.	Lentiviral vector encoding a doxycycline inducible EGFP reporter downstream of FLAG-tagged spCas9, separated by a P2A self-cleavage sequence pInducer-20
Lenti-multi-CRISPR			Puromycin	Yan	An easy and efficient inducible CRISPR/Cas9 platform with improved specificity for multiple gene targeting. Nucleic Acids Res. 2016 Nov 2;44(19):e149. Epub 2016 Jul 25.	Lentiviral vector for the delivery of multiple sgRNAs targeting different genes with constitutive Cas9 expression Lenti-CRISPR
pAAV-RSV-SpCas9	pRSV (Other)	pRSV		Lei	The CRISPR/Cas9-created MDM2 T309G enhances vitreous-induced expression of MDM2 and proliferation and survival of cells. J Biol Chem. 2016 May 31. pii: jbc.M116.729467.	Express SpCas9 in mammalian cells pAAV
pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPRE	U6-modified-sgRNA-Backbone-EFS-hSaCas9-2xNLS-2A-Puro (Synthetic)		Puromycin	Regev	A Distinct Gene Module for Dysfunction Uncoupled from Activation in Tumor-Infiltrating T Cells. Cell. 2016 Sep 8;166(6):1500-1511.e9. doi: 10.1016/j.cell.2016.08.052.	Lentiviral vector encoding modified SaCas9 system backbone bearing BsmBI site for new guide RNAs and puromycin selection marker. pLKO
FUCas9Cyan	humanised S.pyrogenes Cas9 (Other)	hUBC		Herold	(unpublished)	Expresses Cas9 with fluorescent Cyan reporter FUGW
FUCas9GFP	humanised S.pyogenes Cas9 (Other)	hUBC		Herold	(unpublished)	Expresses Cas9 with green fluorescent reporter FUGW
pLenti-Cas9-GFP	Cas9-GFP (Synthetic)	EFS		Sabatini	Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.	Lentiviral vector expressing Cas9-GFP pLentiCRISPR v1
pY036_ATP1A1_G3_Array	ATP1A1 G3 crRNA + user-specified crRNA + AsCpf1-3xHA (Other)	CBh		Doyon	Marker-free coselection for CRISPR-driven genome editing in human cells. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265.	Vector for expression of a CRISPR/AsCpf1 array containing the ATP1A1 G3 guide in combination with a user-specified guide. Cloning of oligos for the second guide using BbsI sites. PY036-like plasmid pY036-U6-crRNA(BbsI)-CBh-AsCpf1
pY036_ATP1A1_G5_Array	ATP1A1 G5 crRNA + user-specified crRNA + AsCpf1-3xHA (Other)	CBh		Doyon	Marker-free coselection for CRISPR-driven genome editing in human cells. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265.	Vector for expression of a CRISPR/AsCpf1 array containing the ATP1A1 G5 guide in combination with a user-specified guide. Cloning of oligos for the second guide using BbsI sites. PY036-like plasmid pY036-U6-crRNA(BbsI)-CBh-AsCpf1
pAAV-Neo_CAG-Cas9	Cas9 (Other)	pCag	Neomycin (select with G418)	Vallier	Optimized inducible shRNA and CRISPR/Cas9 platforms for in vitro studies of human development using hPSCs. Development. 2016 Dec 1;143(23):4405-4418.	Cas9 expression vector for targeting to the AAVS1 locus AAVS1-SA-2A-NEO-CAG-RTTA3 Addgene 60431
Hygro-Cas9 donor	hSpCas9 (Other)		Hygromycin	Huangfu	Genome Editing in hPSCs Reveals GATA6 Haploinsufficiency and a Genetic Interaction with GATA4 in Human Pancreatic Development. Cell Stem Cell. 2017 Feb 8. pii: S1934-5909(17)30001-2. doi: 10.1016/j.stem.2017.01.001.	Donor vector for genomic targeting of a Tetracycline-inducible Cas9 cassette to the human AAVS1/PPP1R12C locus with hygromycin selection N/A
pU6-(BbsI)sgRNA_CAG-Cas9-venus-bpA	Cas9-venus (Synthetic)	CAG		Kuehn	Kuehn -sgRNA plasmids (unpublished)	For cloning and expression of sgRNA together with expression of a Cas9-Venus fusion protein Bluescript
pU6-(BbsI)sgRNA_CAG-Cas9-bpA_EF1-TagRFP	Cas9 (Other)	CAG		Kuehn	Kuehn -sgRNA plasmids (unpublished)	For cloning and expression of sgRNA together with expression of Cas9 and TagRFP Bluescript
pCAG-1BPNLS-Cas9-1BPNLS	1BPNLS-Cas9-1BPNLS (Synthetic)	CAG		Belmonte	In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16.	BPNLS-Cas9-BPNLS expression plasmid pCAG
pCAG-1BPNLS-Cas9-1BPNLS-2AGFP	1BPNLS-Cas9-1BPNLS-2A-EGFP (Synthetic)	CAG		Belmonte	In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16.	BPNLS-Cas9-BPNLS-2AGFP expression plasmid pCAG
pAAV-nEFCas9	nEF-Cas9 (Synthetic)			Belmonte	In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16.	SpCas9 expression AAV backbone plasmid under control of nEF promoter PX551
lenti-Cas9-VQR-Blast	SpCas9-VQR(D1135V,R1335Q,T1337R) (Other)		Blasticidin	Bauer	Variant-aware saturating mutagenesis using multiple Cas9 nucleases identifies regulatory elements at trait-associated loci. Nat Genet. 2017 Feb 20. doi: 10.1038/ng.3793.	lentiviral expression of SpCas9-VQR (NGA PAM restricted) lentiCas9-Blast
P628_SpCas9-RecA	RecA (Synthetic)	CBh		Luo	Fusion of SpCas9 to E. coli Rec A protein enhances CRISPR-Cas9 mediated gene knockout in mammalian cells. J Biotechnol. 2017 Mar 1;247:42-49. doi: 10.1016/j.jbiotec.2017.02.024.	Human codon optimized RecA protein was fused to SpCas9 for enhanced genome editing efficiency PX459
P823_eSpCas9(1.1)-RecA	RecA	CBh		Luo	Fusion of SpCas9 to E. coli Rec A protein enhances CRISPR-Cas9 mediated gene knockout in mammalian cells. J Biotechnol. 2017 Mar 1;247:42-49. doi: 10.1016/j.jbiotec.2017.02.024.	Human codon optimized RecA protein was fused to eSpCas9(1.1) for enhanced genome editing efficiency eSpCas9(1.1)
TLCV2	Cas9-2A-eGFP	Tight TRE promoter, Tight TRE promoter	Puromycin	Karpf	Inducible LentiCRISPR v2 (unpublished)	LentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression. lentiCRISPR v2 Tag / Fusion Protein Cas9-T2A-eGFP
pCSDest2-NmeCas9-NLS-3XHA-NLS	Nme Cas9 (Other)	CMV		Sontheimer	Naturally Occurring Off-Switches for CRISPR-Cas9. Cell. 2016 Dec 15;167(7):1829-1838.e9. doi: 10.1016/j.cell.2016.11.017. Epub 2016 Dec 8.	Mammalian expression of wild type Nme Cas9 pCSDest2
SIN-CMV-Ca9-WPRE	spCas9 (Other)	CMV		Déglon	The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991	Transfer plasmid for the production of lentiviral vectors SIN lentiviral transfer vector
SIN-PGK-Cas9-V5-WPRE	spCas9 (Other)	mouse PGK		Déglon	The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991	To produce lentiviral vector for Cas9 editing SIN lentiviral transfer vector
SIN-PGK-Cas9-WPRE	hCas9 (Other)	mouse PGK		Déglon	The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991	To produce Lentiviral vector for gene editing HIV-1 lentiviral SIN transfer vector
SIN-CMV-Cas9-V5-WPRE	Cas9-V5 (Other)	CMV		Déglon	The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991	To produce lentiviral vector for gene editing HIV-1 SIN lentiviral transfer vector
pTE4254	St chimeric gRNA, hStCas9	human U6, CMV	Neomycin (select with G418)	Welker	Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0.	Expresses St chimeric gRNA and human codon-optimized StCas9 pcDNA3.3-TOPO
pKS7107	Nm crRNA, Nm tracrRNA, hNmCas9	human U6, human U6, EF1a		Welker	Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0.	Expresses Nm crRNA, Nm tracrRNA and human codon-optimized NmCas9 pSimpleII
pcDNA3.1-hAsCpf1(TYCV) (pY210)	Acidaminococcus sp. Cpf1 (RR variant) (Synthetic)	CMV		Zhang	Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900.	Expresses humanized AsCpf1 variant that recognizes TYCV PAMs pcDNA3.1
pAsCpf1(TYCV)(BB) (pY211)	Acidaminococcus sp. Cpf1 (RR variant) (Synthetic)	CBh		Zhang	Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900.	Expresses humanized AsCpf1 TYCV PAM variant and crRNA guide pUC ori vector
pcDNA3.1-hAsCpf1(TATV) (pY220)	Acidaminococcus sp. Cpf1 (RVR variant) (Synthetic)	CMV		Zhang	Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900.	Expresses humanized AsCpf1 variant that recognizes TATV PAMs pcDNA3.1
pAsCpf1(TATV)(BB) (pY221)	Acidaminococcus sp. Cpf1 (RVR variant) (Synthetic)	CBh		Zhang	Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900.	Expresses humanized AsCpf1 TATV PAM variant and crRNA guide pUC ori vector
pcDNA3.1-hLbCpf1(TYCV) (pY230)	Lachnospiraceae bacterium Cpf1 (RR variant) (Synthetic)	CMV		Zhang	Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900.	Expresses humanized LbCpf1 variant that recognizes TYCV PAMs pcDNA3.1
L40C-CRISPR.EFS.dTomato				Heckl	CRISPR-Cas9-induced t(11;19)/MLL-ENL translocations initiate leukemia in human hematopoietic progenitor cells in vivo. Haematologica. 2017 Jun 1. pii: haematol.2017.164046. doi: 10.3324/haematol.2017.164046.	Lentiviral CRISPR-Cas9 delivery for sgRNA (hU6), dTomato coexpression, EFS Promoter driven SIN40C
L40C-CRISPR.EFS.PAC			Puromycin	Heckl	CRISPR-Cas9-induced t(11;19)/MLL-ENL translocations initiate leukemia in human hematopoietic progenitor cells in vivo. Haematologica. 2017 Jun 1. pii: haematol.2017.164046. doi: 10.3324/haematol.2017.164046.	Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), PAC (Puromycin resistance) coexpression, EFS Promoter driven SIN40C
pRGEN-CMV-CjCas9	Cas9 derived from compylobacter Jejuni (Other)			Kim	In vivo genome editing with a small Cas9 orthologue derived from Campylobacter jejuni. Nat Commun. 2017 Feb 21;8:14500. doi: 10.1038/ncomms14500.	Expression of CjCas9 in mammalian cells pcDNA3.1
CAG-Cas9	hCas9 (Other)	CAG		Otonkoski	Generation of an OCT4 reporter human induced pluripotent stem cell line using CRISPR/SpCas9. Stem Cell Res. 2017 Aug;23:105-108. doi: 10.1016/j.scr.2017.07.006. Epub 2017 Jul 11.	Expresses high levels of WT Cas9 for genome editing pCAG
CAG-SaCas9-WPRE	SaCas9 (Other)	CAG		Otonkoski	Generation of a SOX2 reporter human induced pluripotent stem cell line using CRISPR/SaCas9. Stem Cell Res. 2017 Jul;22:16-19. doi: 10.1016/j.scr.2017.05.005. Epub 2017 May 17.	Expresses high levels of WT SaCas9 for genome editing pCAG NEWENTRY
DD-Cas9 with filler sequence and Venus (EDCPV)	Cas9 (Synthetic)	EFS		Sordella	Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization. Nat Commun. 2017 Feb 22;8:14370. doi: 10.1038/ncomms14370.	This plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be remove for cloning of desired sgRNA lentiCRISPR v2
DD-Cas9 with filler sequence and Cre-ERT2 (EDCICE)	Cas9 (Synthetic)	EFS		Sordella	Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization. Nat Commun. 2017 Feb 22;8:14370. doi: 10.1038/ncomms14370.	This plasmid contains destabilized Cas9 and has Cre-ERT2 after IRES sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNA lentiCRISPR v2
pSpCas9(BB)-2A-miRFP670	hSpCas9-2A-miRFP670 (Synthetic), BB-guide RNA (Synthetic)	Cbh, U6		Kuehn	pSpCas9(BB)-2A-miRFP670 (unpublished)	Cas9 from S. pyogenes with 2A-miRFP670, and cloning backbone for sgRNA. Modified Zhang Plasmid #62988 PX459
LcV2-Hygro			Hygromycin	Mendell	An Argonaute phosphorylation cycle promotes microRNA-mediated silencing. Nature. 2017 Feb 9;542(7640):197-202. doi: 10.1038/nature21025. Epub 2017 Jan 23.	LentiCRISPR v2 with Hygro cloned in place of Puro LentiCRISPR v2
pX330-Flag-SpCas9-HF1 (without sgRNA)	3xFlag-NLS-Streptococcus pyogenes Cas9-HF1-NLS (Other)	Cbh		Welker	Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8.	Expression plasmid for human codon-optimized high-fidelity SpCas9-HF1, px330-like backbone (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
HeFm1SpCas9	3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity mut1 Cas9-NLS (Other)	Cbh		Welker	Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8.	Expression plasmid for human codon-optimized increased fidelity HeFm1SpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
HeFm2SpCas9	“Highly enhanced Fidelity” mut2 SpCas9 (Other)	Cbh		Welker	Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8.	Expression plasmid for human codon-optimized increased fidelity HeFm2SpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
pY111 (pcDNA3.1-huTsCpf1)	huTsCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized TsCpf1 pcDNA3.1
pY112 (pcDNA3.1-huSaCpf1)	huSaCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized SaCpf1 pcDNA3.1
pY113 (pcDNA3.1-huPb2Cpf1)	huPb2Cpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized Pb2Cpf1 pcDNA3.1
pY114 (pcDNA3.1-huPgCpf1)	huPgCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized PgCpf1 pcDNA3.1
pY115 (pcDNA3.1-huMlCpf1)	huMlCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized MlCpf1 pcDNA3.1
pY116 (pcDNA3.1-huMb2Cpf1)	huMb2Cpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized Mb2Cpf1 pcDNA3.1
pY117 (pcDNA3.1-huMb3Cpf1)	huMb3Cpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized Mb3Cpf1 pcDNA3.1
pY118 (pcDNA3.1-huLb4Cpf1)	huLb4Cpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized Lb4Cpf1 pcDNA3.1
pY119 (pcDNA3.1-huLb5Cpf1)	huLb5Cpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized Lb5Cpf1 pcDNA3.1
pY120 (pcDNA3.1-huFbCpf1)	huFbCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized FbCpf1 pcDNA3.1
pY122 (pcDNA3.1-huCPbCpf1)	huCPbCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized CPbCpf1 pcDNA3.1
pY123 (pcDNA3.1-huCMaCpf1)	huCMaCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized CMaCpf1 pcDNA3.1
pY124 (pcDNA3.1-huBsCpf1)	huBsCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized BsCpf1 pcDNA3.1
pY125 (pcDNA3.1-huBfCpf1)	huBfCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized BfCpf1 pcDNA3.1
pY126 (pcDNA3.1-huBoCpf1)	huBoCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized BoCpf1 pcDNA3.1
pY127 (pcDNA3.1-U6-huTsCpf1)	huTsCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized TsCpf1 and crRNA pcDNA3.1
pY128 (pcDNA3.1-U6-huMb2Cpf1)	huMb2Cpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized Mb2Cpf1 and crRNA pcDNA3.1
pY129 (pcDNA3.1-U6-huMb3Cpf1)	huMb3Cpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized Mb3Cpf1 and crRNA pcDNA3.1
pY130 (pcDNA3.1-U6-huBsCpf1)	huBsCpf1 (Other)			Zhang	Zhang lab Cpf1 plasmids (unpublished)	Expression of humanized BsCpf1 and crRNA pcDNA3.1
pX330-Flag-wtSpCas9 (without sgRNA)	3xFlag-NLS-wild-type SpCas9-NLS (Other)	Cbh		Welker	Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8.	Expression plasmid for human codon-optimized wild-type SpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
pX330-Flag-eSpCas9 (without sgRNA)	3xFLAG-NLS-Streptococcus pyogenes enhanced Cas9-NLS (Other)	Cbh		Welker	Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8.	Expression plasmid for human codon-optimized high-fidelity eSpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
HeFSpCas9	3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity Cas9-NLS (Other)	Cbh		Welker	Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8.	Expression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
pCAG Cas9-2A-Citrine	Cas9 2A Citrine (Other)			Sauka-Spengler	Genome and epigenome engineering CRISPR toolkit for probing in vivo cis-regulatory interactions in the chicken embryo BioRxiv	CAG-driven ubiquitous expression of Cas9. Contains 2A-Citrine reporter. For CRISPR mediated gene knockouts in chicken embryos. pCAG
pTK Cas9-2A-Citrine	Cas9 2A Citrine (Other)	thymidine kinase promoter		Sauka-Spengler	Genome and epigenome engineering CRISPR toolkit for probing in vivo cis-regulatory interactions in the chicken embryo BioRxiv	Enhancer/reporter plasmid for tissue-specific expression of Cas9 with 2A-Citrine reporter. Contains BsmBI-flanked LacZ cloning cassette for rapid GoldenGate-based cloning of specific enhancers. pTK
pCI Cas9 H2B-RFP	Cas9 (Other)	CAG		Sauka-Spengler	Genome and epigenome engineering CRISPR toolkit for probing in vivo cis-regulatory interactions in the chicken embryo BioRxiv	CAG-driven ubiquitous expression of Cas9 with Histone2B-RFP reporter controlled by IRES pCI IRES H2B RFP
pXPR_206			Puromycin	Root	Orthologous CRISPR-Cas9 enzymes for combinatorial genetic screens. Nat Biotechnol. 2018 Feb;36(2):179-189. doi: 10.1038/nbt.4048. Epub 2017 Dec 18.	for SaCas9 knockout, lentiviral expression of SaCas9 and gRNA scaffold pXPR
pPapi			Puromycin	Root	Orthologous CRISPR-Cas9 enzymes for combinatorial genetic screens. Nat Biotechnol. 2018 Feb;36(2):179-189. doi: 10.1038/nbt.4048. Epub 2017 Dec 18.	lentiviral expression of SaCas9 and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in Stable SpCas9 expressing cell lines for dual Cas9 "Big Papi" screens. Alt name pXPR207. pXPR
pLX_311-Cas9	Cas9 (Other)	EF1a	Blasticidin	Hahn	Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014 Sep 3. doi: 10.1038/nbt.3026.	for Cas9 knockout, lentiviral expression of Cas9. Alternate plasmid name: pXR111 pXPR
AAV_Efs_hSpCas9_NLS_FLAG-SV40	humanized S. pyogenes Cas9 (Synthetic)	EFS		Yang	Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76.	AAV vector for encoding a human codon-optimized SpCas9 driven by EFs promoter pAAV Tag / Fusion Protein Flag (C terminal on insert)
Lenti_Efs_hSpCas9_NLS_FLAG-WPRE	humanized S. pyogenes Cas9 (Synthetic)	EFS		Yang	Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76.	Lentiviral vector for encoding a human codon-optimized SpCas9 driven by EFs promoter. Lenti virus Tag / Fusion Protein Flag (C terminal on insert)
lentiCRISPRv2 puro	P2A-puro	EF-1a	Puromycin	Stringer	Brett Stringer Lab Plasmids (unpublished)	Variant of lentiCRISPRv2 that confers puromycin resistance lentiCRISPRv2
lentiCRISPRv2 hygro	P2A-hygro	EF-1a	Hygromycin	Stringer	Brett Stringer Lab Plasmids (unpublished)	Variant of lentiCRISPRv2 that confers hygromycin resistance lentiCRISPRv2
lentiCRISPRv2 neo	P2a-neo	EF-1a	Neomycin (select with G418)	Stringer	Brett Stringer Lab Plasmids (unpublished)	Variant of lentiCRISPRv2 that confers G418 resistance lentiCRISPRv2
lentiCRISPRv2 blast	P2a-blast	EF-1a	Blasticidin	Stringer	Brett Stringer Lab Plasmids (unpublished)	Variant of lentiCRISPRv2 that confers blasticidin S resistance lentiCRISPRv2
px330-mcherry		U6	mCherry	Li	Correction of a genetic disease in mouse via use of CRISPR-Cas9. Cell Stem Cell. 2013 Dec 5;13(6):659-62. doi: 10.1016/j.stem.2013.10.016.	Cas9 from S.pyogenes with CMV-mcherry cassette, and cloning backbone for sgRNA pX330
pCAGG>nls-hCas9-nls	humanized Cas9	Chicken beta actin (CAG)		Bronner	Optimization of CRISPR/Cas9 genome editing for loss-of-function in the early chick embryo. Dev Biol. 2017 Dec 1;432(1):86-97. doi: 10.1016/j.ydbio.2017.08.036.	Expresses Cas9 via the chicken beta actin promoter for electroporation in chicken embryos pCI
pCAGG>nls-hCas9-nls-GFP	Cas9-GFP	Chicken beta actin (CAG)		Bronner	Optimization of CRISPR/Cas9 genome editing for loss-of-function in the early chick embryo. Dev Biol. 2017 Dec 1;432(1):86-97. doi: 10.1016/j.ydbio.2017.08.036.	Cas9-GFP fusion protein under the regulation of chicken beta-actin promoter pCI
LentiCRISPRv2-mCherry	Cas9 (Synthetic), mCherry (Other)	EFS-NS, EFS-NS	mCherry	Smogorzewska	LentiCRISPRv2-mCherry (unpublished)	Lentiviral vector encoding sgRNA cloning site + hSpCAS9-P2A-mCherry. LentiCRISPRv2
CROPseq-Guide-EFS-SpCas9-P2A-EGFP		EFS		Hewitt	CROPseq-Guide-EFS-SpCas9-P2A-EGFP (unpublished)	single-vector system with EGFP reporter for use in CROPseq knockout screens CROPseq-Guide-Puro Tag / Fusion Protein EGFP (C terminal on backbone)
ciCas9_pcDNA5	ciCas9		Hygromycin	Maly	Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368.	Expresses ciCas9 in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables. pcDNA5/FRT/TO
e-ciCas9_pcDNA5	e-ciCas9		Hygromycin	Maly	Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368.	Expresses enhanced specificity ciCas9 (e-ciCas9) in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables. pcDNA5/FRT/TO
eSpCas9(1.1)-T2A-Puro		CBh	Puromycin	Németh	eSpCas9(1.1)-T2A-Puro (unpublished)	Enhanced SpCas9(1.1) with puromycin resistance gene via T2A linker. eSpCas9(1.1) Tags / Fusion Proteins 3xFLAG (N terminal on insert) T2A-Puro (C terminal on insert)
BPK3258 - human expression plasmid for eSpCas9(1.1)	hSpCas9-eSpCas9(1.1)(K848A/K1003A/R1060A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 eSpCas9(1.1) variant: CMV-T7-hSpCas9-eSpCas9(1.1)(K848A, K1003A, R1060A)-NLS(SV40)-3xFLAG JDS246
BPK3274 - human expression plasmid for eSpCas9(1.1)-HF1	hSpCas9-eSpCas9(1.1)-HF1(N497A/R661A/Q695A/K848A/Q926A/K1003A/R1060A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant: CMV-T7-hSpCas9-eSpCas9(1.1)-HF1(N497A, R661A, Q695A, K848A, Q926A, K1003A, R1060A)-NLS(SV40)-3xFLAG JDS246
BPK4410 - human expression plasmid for SpCas9 Cluster 1 (HypaCas9)	hSpCas9-Cluster1(N692A/M694A/Q695A/H698A)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 1 variant (HypaCas9): CMV-T7-hSpCas9-Cluster1(N692A, M694A, Q695A, H698A)-NLS(SV40)-3xFLAG JDS246
MMW3709 - human expression plasmid for SpCas9 Cluster 1 + Q926A	hSpCas9-Cluster1+Q926A(N692A/M694A/Q695A/H698A/Q926A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 1 + Q926A variant: CMV-T7-hSpCas9-Cluster1+Q926A(N692A, M694A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
MMW3914 - human expression plasmid for SpCas9 Cluster 1 H698 + Q926A	hSpCas9-Cluster1H698+Q926A(N692A/M694A/Q695A/Q926A)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 1 H698 + Q926A variant: CMV-T7-hSpCas9-Cluster1H698+Q926A(N692A, M694A, Q695A, Q926A)-NLS(SV40)-3xFLAG JDS246
MMW3689 - human expression plasmid for SpCas9 Cluster 1 Q695 + Q926A	hSpCas9-Cluster1Q695+Q926A(N692A/M694A/H698A/Q926A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 1 Q695 + Q926A variant: CMV-T7-hSpCas9-Cluster1Q695+Q926A(N692A, M694A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
MMW3911 - human expression plasmid for SpCas9 Cluster 1 M694 + Q926A	hSpCas9-Cluster1M694+Q926A(N692A/Q695A/H698A/Q926A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 1 M694 + Q926A variant: CMV-T7-hSpCas9-Cluster 1M694+Q926A(N692A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
MMW3909 - human expression plasmid for SpCas9 Cluster 1 N692 + Q926A	hSpCas9-Cluster1N692+Q926A(M694A/Q695A/H698A/Q926A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 1 N692 + Q926A variant: CMV-T7-hSpCas9-Cluster1N692+Q926A(M694A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
MMW3001 - human expression plasmid for SpCas9 Cluster 2 + Q926A	hSpCas9-Cluster2+Q926A(G582A/V583A/E584A/D585A/N588A/Q926A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 2 + Q926A variant: CMV-T7-hSpCas9-Cluster2+Q926A(G582A, V583A, E584A, D585A, N588A, Q926A)-NLS(SV40)-3xFLAG JDS246
MMW2993 - human expression plasmid for SpCas9 Cluster 2	hSpCas9-Cluster2(G582A/V583A/E584A/D585A/N588A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 2 variant: CMV-T7-hSpCas9-Cluster2(G582A, V583A, E584A, D585A, N588A)-NLS(SV40)-3xFLAG JDS246
MMW3645 - human expression plasmid for SpCas9 Cluster 3	hSpCas9-Cluster3(T657A/G658A/W659A/R661A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 3 variant: CMV-T7-hSpCas9-Cluster3(T657A, G658A, W659A, R661A)-NLS(SV40)-3xFLAG JDS246
MMW3629 - human expression plasmid for SpCas9 Cluster 3 + Q926A	hSpCas9-Cluster3+Q926A(T657A/G658A/W659A/R661A/Q926A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 3 + Q926A variant: CMV-T7-hSpCas9-Cluster3+Q926A(T657A, G658A, W659A, R661A, Q926A)-NLS(SV40)-3xFLAG JDS246
MMW3770 - human expression plasmid for SpCas9 Cluster 4	hSpCas9-Cluster4(F491A/M495A/T496A/N497A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 4 variant: CMV-T7-hSpCas9-Cluster4(F491A, M495A, T496A, N497A)-NLS(SV40)-3xFLAG JDS246
MMW3759 - human expression plasmid for SpCas9 Cluster 4 + Q926A	hSpCas9-Cluster4+Q926A(F491A/M495A/T496A/N497A/Q926A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 4 + Q926A variant: CMV-T7-hSpCas9-Cluster4+Q926A(F491A, M495A, T496A, N497A, Q926A)-NLS(SV40)-3xFLAG JDS246
BPK4387 - human expression plasmid for SpCas9 Cluster 5	hSpCas9-Cluster5(K918A/V922A/R925A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 5 variant: CMV-T7-hSpCas9-Cluster5(K918A, V922A, R925A)-NLS(SV40)-3xFLAG JDS246
BPK4393 - human expression plasmid for SpCas9 Cluster 5 + Q926A	hSpCas9-Cluster5+Q926A(K918A/V922A/R925A/Q926A) (Synthetic)	CMV		Joung	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Human expression plasmid for SpCas9 Cluster 5 + Q926A variant: CMV-T7-hSpCas9-Cluster5+Q926A(K918A, V922A, R925A, Q926A)-NLS(SV40)-3xFLAG JDS246
px459 VQR	SpCas9 VQR (Other)		Puromycin	Holland	AID Chapter plasmids (unpublished)	sgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM) px459 v2
px459 VRER	SpCas9 VRER (Other)		Puromycin	Holland	AID Chapter plasmids (unpublished)	sgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM) px459 v2
p458 VQR	SpCas9 VQR (Other)		EGFP	Holland	px458 VQR (unpublished)	Expresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifs px458
p458 VRER	SpCas9 VRER (Other)		EGFP	Holland	px458 VQR (unpublished)	Expresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifs px458
px330 VRER	SpCas9 VRER (Other)			Holland	px458 VQR (unpublished)	Expresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifs px330
p330 VQR	SpCas9 VQR (Other)			Holland	px458 VQR (unpublished)	Expresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifs px330
px458 EQR	SpCas9 EQR (Other)		EGFP	Holland	px458 VQR (unpublished)	Expresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifs px458
px459 EQR	SpCas9 EQR (Other)		Puromycin	Holland	px458 VQR (unpublished)	Expresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifs px459 v2
px330 EQR	SpCas9 EQR (Other)			Holland	px458 VQR (unpublished)	Expresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifs px330
pLCRISPR-CMV				Manel	Transmission of innate immune signaling by packaging of cGAMP in viral particles. Science. 2015 Sep 11;349(6253):1232-6. doi: 10.1126/science.aab3628. Epub 2015 Jul 30.	Control lentivector expressing Cas9 and gRNA scaffold pLCRISPR
PCS2+Cas9-mSA	CAS9-MSA (Other)	SP6		Rossant	Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166.	Cas9 mSA for in vitro transcription for gene editing in Mouse Embryos PCS2+
p3s-Cas9-HN	Cas9-WT (Other)	CMV		Kim	Rescue of high-specificity Cas9 variants using sgRNAs with matched 5' nucleotides. Genome Biol. 2017 Nov 15;18(1):218. doi: 10.1186/s13059-017-1355-3.	Cas9-WT mammalian expression p3s Tag / Fusion Protein HA (N terminal on backbone)
p3s-eCas9-1.1	eCas9-1.1 (Other)	CMV		Kim	Rescue of high-specificity Cas9 variants using sgRNAs with matched 5' nucleotides. Genome Biol. 2017 Nov 15;18(1):218. doi: 10.1186/s13059-017-1355-3.	eCas9-1.1 mammalian expression p3s Tag / Fusion Protein HA (N terminal on backbone)
p3s-Cas9-HF1	Cas9-HF1 (Other)	CMV		Kim	Rescue of high-specificity Cas9 variants using sgRNAs with matched 5' nucleotides. Genome Biol. 2017 Nov 15;18(1):218. doi: 10.1186/s13059-017-1355-3.	Cas9-HF1 mammalian expression p3s Tag / Fusion Protein HA (N terminal on backbone)
pAAV-EFS-SpCas9	Streptococcus pyogenes Cas9 (Synthetic)	EFS		Yasuda	Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain. Neuron. 2017 Oct 18. pii: S0896-6273(17)30933-9. doi: 10.1016/j.neuron.2017.10.004.	AAV vector expressing Myc-tagged SpCas9 under the EFS promoter PX551
lenti-SpCas9 puro	KpnI-XhoI-BsrGI-NheI (Synthetic)		Puromycin	Stringer	An expanded set of lentiCRISPRv2, lentiGuide and lentiCas9 plasmid vectors (unpublished)	This 3rd generation lentiviral construct delivers hSpCas9 and puromycin resistance. lentiCRISPRv2 puro (Addgene #98290)
lenti-SpCas9 hygro	KpnI-XhoI-BsrGI-NheI (Synthetic)		Hygromycin	Stringer	An expanded set of lentiCRISPRv2, lentiGuide and lentiCas9 plasmid vectors (unpublished)	This lentiviral construct delivers hSpCas9 and hygromycin resistance. lentiCRISPRv2 hygro (Addgene #98291)
lenti-SpCas9 neo	KpnI-XhoI-BsrGI-NheI (Synthetic)		Neomycin (select with G418)	Stringer	An expanded set of lentiCRISPRv2, lentiGuide and lentiCas9 plasmid vectors (unpublished)	This lentiviral construct delivers hSpCas9 and G418 resistance. lentiCRISPRv2 neo (Addgene #98292)
lenti-SpCas9 blast	KpnI-XhoI-BsrGI-NheI (Synthetic)		Blasticidin	Stringer	An expanded set of lentiCRISPRv2, lentiGuide and lentiCas9 plasmid vectors (unpublished)	This lentiviral construct delivers hSpCas9 and blasticidin S resistance. lentiCRISPRv2 blast (Addgene #98293)
pMB-SaCas9	Cas9 nuclease (Other)	short EF1alpha	Hygromycin ; mouse CD4	McManus	Dual gene activation and knockout screen reveals directional dependencies in genetic networks. Nat Biotechnol. 2018 Jan 15. pii: nbt.4062. doi: 10.1038/nbt.4062.	SaCas9 expression vector pBR322
pSECB			Blasticidin	Possemato	Serine Catabolism by SHMT2 Is Required for Proper Mitochondrial Translation Initiation and Maintenance of Formylmethionyl-tRNAs Mol. Cell (2018) Volume 69, Issue 4, p610–621.e5	Express spCas9 with sgRNA, blast resistance pSECB
AAV-CMVc-Cas9	Cas9 (Synthetic)	CMVc		Belmonte	In Vivo Target Gene Activation via CRISPR/Cas9-Mediated Trans-epigenetic Modulation. Cell. 2017 Dec 14;171(7):1495-1507.e15. doi: 10.1016/j.cell.2017.10.025. Epub 2017 Dec 7.	Expresses SpCas9 from the CMVc promoter in AAV backbone AAV
CROPseq-EFS-SpCas9-P2A-blast		EFS	Blasticidin	Hewitt	CROPseq plasmids (unpublished)	single-vector CROPseq system with blasticidin resistance selection for use in the CROPseq CRISPR knockout screens CROPseq-Guide-EFS-SpCas9-P2A-EGFP
CROPseq-EFS-HypaSpCas9-P2A-EGFP	HypaSpCas9 (Synthetic)	EFS	EGFP	Hewitt	CROPseq plasmids (unpublished)	single-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screen CROPseq-Guide-EFS-SpCas9-P2A-EGFP
CROPseq-EFS-HypaSpCas9-P2A-puro	HypaSpCas9 (Synthetic)	EFS	Puromycin	Hewitt	CROPseq plasmids (unpublished)	single-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screen CROPseq-Guide-EFS-SpCas9-P2A-puro
pX551-CMV-SpCas9	SpCas9 (Other)			Hewitt	Alex Hewitt Lab plasmids (unpublished)	AAV plasmid expressing Cas9 under control of CMV promoter, by replaceing mecp2 promoter in pX551 from Zhang lab pAAV
pX551-miniCMV-SpCas9	SpCas9 (Other)			Hewitt	Alex Hewitt Lab plasmids (unpublished)	AAV plasmid expressing Cas9 under control of miniCMV promoter pAAV
pX551-miniCMV-SaCas9	SaCas9 (Other)			Hewitt	Alex Hewitt Lab plasmids (unpublished)	AAV plasmid expressing SaCas9 under control of miniCMV promoter pAAV
pX551-miniCMV-CjCas9	CjCas9 (Other)			Hewitt	Alex Hewitt Lab plasmids (unpublished)	AAV plasmid expressing CjCas9 under control of miniCMV promoter pAAV
pX551-miniCMV-AsCpf1	AsCpf1 (Other)			Hewitt	Alex Hewitt Lab plasmids (unpublished)	AAV plasmid expressing AsCpf1 under control of miniCMV promoter pAAV
pX551-CMV-CjCas9	CjCas9 (Other)			Hewitt	Alex Hewitt Lab plasmids (unpublished)	AAV plasmid expressing CjCas9 under control of CMV promoter pAAV
pX601 miniCMV-SaCas9-SpA-sgRNA scaffold				Hewitt	Alex Hewitt Lab plasmids (unpublished)	Backbone vector for cloning in target sgRNA for use with SaCas9 pAAV
pSP64T-hLbCpf1	hLbCpf1 (Homo sapiens)	sp6		Giraldez	CRISPR-Cpf1 mediates efficient homology-directed repair and temperature-controlled genome editing. Nat Commun. 2017 Dec 8;8(1):2024. doi: 10.1038/s41467-017-01836-2.	plasmid to carry out IVT of human codon optimized LbCpf1 (from Addgene; 69988) pSP64T
pAAVS1-TRE-Cas9- puro-polyA-CAG-rtTA	hSpCas9 (Other), rtTA, bGH polyA-SV40polyA	TRE, CAG	Puromycin	Menéndez	Generation and characterization of a human iPSC cell line expressing inducible Cas9 in the "safe harbor" AAVS1 locus. (unpublished)	Expresses Cas9 upon induction with doxicycline. N/A
pTE3320	hLbCpf1(RVR)	CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses human codon optimized LbCpf1(RVR mutant) in mammalian cells. pcDNA3.1
pTE3314	hFnCpf1(RVR)	CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses human codon optimized FnCpf1(RVR mutant) in mammalian cells. pcDNA3.1
pTE3317	hMbCpf1(RVR)	CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses human codon optimized MbCpf1(RVR mutant) in mammalian cells. pcDNA3.1
pTE3316	hFnCpf1(RR)	CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses human codon optimized FnCpf1(RR mutant) in mammalian cells. pcDNA3.1
pTE3319	hMbCpf1(RR)	CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses human codon optimized MbCpf1(RR mutant) in mammalian cells. pcDNA3.1
pTE3330	Lb crRNA, hLbCpf1(RVR mutant)	human U6, CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses Lb crRNA and human codon optimized LbCpf1(RVR mutant) in mammalian cells. pcDNA3.1
pTE3327	As crRNA, hAsCpf1(RVR mutant)	human U6, CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses As crRNA and human codon optimized AsCpf1(RVR mutant) in mammalian cells. pcDNA3.1
pTE3331	Fn crRNA, hFnCpf1(RVR mutant)	human U6, CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses Fn crRNA and human codon optimized FnCpf1(RVR mutant) in mammalian cells. pcDNA3.1
pTE3334	Mb crRNA, hMbCpf1(RVR mutant)	human U6, CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses Mb crRNA and human codon optimized MbCpf1(RVR mutant) in mammalian cells. pcDNA3.1
pTE3329	Lb crRNA, hLbCpf1(RR mutant)	human U6, CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses Lb crRNA and human codon optimized LbCpf1(RR mutant) in mammalian cells. pcDNA3.1
pTE3328	As crRNA, hAsCpf1(RR mutant)	human U6, CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses As crRNA and human codon optimized AsCpf1(RR mutant) in mammalian cells. pcDNA3.1
pTE3333	Fn crRNA, hFnCpf1(RR mutant)	human U6, CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses Fn crRNA and human codon optimized FnCpf1(RR mutant) in mammalian cells. pcDNA3.1
pTE3336	Mb crRNA, hMbCpf1(RR mutant)	human U6, CMV	Neomycin (select with G418)	Welker	Cpf1 nuclease and crRNA expressing plasmids (unpublished)	Expresses Mb crRNA and human codon optimized MbCpf1(RR mutant) in mammalian cells. pcDNA3.1
pX-evoCas9	Humanized S. pyogenes Cas9	CBh		Cereseto	A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nat Biotechnol. 2018 Jan 29. pii: nbt.4066. doi: 10.1038/nbt.4066.	Expresses the M495V/Y515N/K526E/R661Q (evoCas9) SpCas9 variant in mammalian cells PX330 (Addgene #42230)
pST1374-Lb-Cpf1-NLS	LbCpf1 (Other)	CMV		Chen	Base editing with a Cpf1-cytidine deaminase fusion. Nat Biotechnol. 2018 Mar 19. pii: nbt.4102. doi: 10.1038/nbt.4102.	Expresses LbCpf1 in mammalian cells Addgene 44758
LentiV_Cas9_puro	Cas9 (Synthetic)	EFS promoter, EFS promoter	Puromycin	Vakoc	LKB1, Salt-Inducible Kinases, and MEF2C Are Linked Dependencies in Acute Myeloid Leukemia. Mol Cell. 2018 Feb 28. pii: S1097-2765(18)30109-6. doi: 10.1016/j.molcel.2018.02.011.	Lentiviral expression plasmid of spCas9 with puromycin resistance gene LentiV_puro
pX459V2.0-eSpCas9(1.1)			Puromycin	Miyaoka	Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research	pX459 V2.0 (Plasmid #62988) with the K848A, K1003A, and R1060A mutations pX459
pX459V2.0-SpCas9-HF1			Puromycin	Miyaoka	Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research	pX459 V2.0 (Plasmid #62988) with the N497A, R661A, Q695A, and Q926A mutations pX459
pX459V2.0-HypaCas9			Puromycin	Miyaoka	Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research	pX459 V2.0 (Plasmid #62988) with the N692A, M694A, Q695A, and H698A mutations pX459
pX459V2.0-SpCas9-HF4			Puromycin	Miyaoka	Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research	pX459 V2.0 (Plasmid #62988) with the Y450A, N497A, R661A, Q695A, and Q926A mutations pX459
pX459V2.0-eSpCas9(1.1)+K810A			Puromycin	Miyaoka	Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research	pX459 V2.0 (Plasmid #62988) with the K810A, K848A, K1003A, and R1060A mutations pX459
pX459V2.0-eSpCas9(1.1)+K855A			Puromycin	Miyaoka	Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research	pX459 V2.0 (Plasmid #62988) with the K848A, K855A, K1003A, and R1060A mutations pX459
pX459V2.0-eSpCas9(1.1)+K810A+K855A			Puromycin	Miyaoka	Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research	pX459 V2.0 (Plasmid #62988) with the K810A, K848A, K855A, K1003A, and R1060A mutations pX459
pX330-SpCas9-HF1				Miyaoka	Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research	pX330 (Plasmid #42230) with the N497A, R661A, Q695A, and Q926A mutations pX330
pX330-HypaCas9				Miyaoka	Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair Nucleic Acids Research	pX330 (Plasmid #42230) with the N692A, M694A, Q695A, and H698A mutations pX330
xCas9 3.7	xCas9 3.7 (Synthetic)			Liu	Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature. 2018 Feb 28. pii: nature26155. doi: 10.1038/nature26155.	Mammalian expression vector for xCas9 3.7 pCMV Tag / Fusion Protein NLS (N terminal on insert)
xCas9 3.6	xCas9 3.6 (Synthetic)			Liu	Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature. 2018 Feb 28. pii: nature26155. doi: 10.1038/nature26155.	Mammalian expression vector for xCas9 3.6 pCMV Tag / Fusion Protein NLS (N terminal on insert)
Myh6-Cas9	Cas9 (Other)	alpha MHC		van Rooij	Postnatal Cardiac Gene Editing Using CRISPR/Cas9 With AAV9-Mediated Delivery of Short Guide RNAs Results in Mosaic Gene Disruption. Circ Res. 2017 Oct 27;121(10):1168-1181. doi: 10.1161/CIRCRESAHA.116.310370. Epub 2017 Aug 29.	Cardiac-specific overexpression of Cas9 alpha MHC
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA				Lagor	Somatic Editing of Ldlr With Adeno-Associated Viral-CRISPR Is an Efficient Tool for Atherosclerosis Research. Arterioscler Thromb Vasc Biol. 2018 Jul 19. pii: ATVBAHA.118.311221. doi: 10.1161/ATVBAHA.118.311221.	Plasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNA pEMBL8
hSyn1-AsCpf1(RR)	hAsCpf1(RR) (Homo sapiens)	hSyn1		Zhang	Effects of 3D culturing conditions on the transcriptomic profile of stem-cell-derived neurons Nature Biomedical Engineering (Epub 09 April 2018)	AAV vector expressing AsCpf1 (RR variant) Custom
pLenti-LbCpf1-U6_FlipArray	U6-FlipArray (Synthetic)	U6	Puromycin	Chen	Programmable sequential mutagenesis by inducible Cpf1 crRNA array inversion. Nat Commun. 2018 May 15;9(1):1903. doi: 10.1038/s41467-018-04158-z.	Lentiviral vector to express Cpf1 from EFS promoter, as well as a Cpf1 FlipArray from U6 promoter. pY109
pMIA3		EF1a		Foo	A Roadmap for Human Liver Differentiation from Pluripotent Stem Cells. Cell Rep. 2018 Feb 20;22(8):2190-2205. doi: 10.1016/j.celrep.2018.01.087.	Expresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSB px330 (addgene #42230) Tags / Fusion Proteins mRuby2 (N terminal on insert) mtp53dn (N terminal on insert)
pCas9-HE	HDR-Enhancer domain of human CtIP protein (Homo sapiens)		Neomycin (select with G418)	Concordet	CtIP fusion to Cas9 enhances transgene integration by homology-dependent repair. Nat Commun. 2018 Mar 19;9(1):1133. doi: 10.1038/s41467-018-03475-7.	Expresses Cas9 fusion to HE (HDR-enhancer) domain of human CtIP protein hCas9 Addgene ID 41815
pCas9-Geminin	Geminin (Homo sapiens)		Neomycin (select with G418)	Concordet	CtIP fusion to Cas9 enhances transgene integration by homology-dependent repair. Nat Commun. 2018 Mar 19;9(1):1133. doi: 10.1038/s41467-018-03475-7.	Expresses Cas9 fusion to Geminin degron domain hCas9 Addgene ID 41815 GMNN Gem, MGORS6
pCas9-HE-Geminin	HE-Geminin		Neomycin (select with G418)	Concordet	CtIP fusion to Cas9 enhances transgene integration by homology-dependent repair. Nat Commun. 2018 Mar 19;9(1):1133. doi: 10.1038/s41467-018-03475-7.	Expresses Cas9 fusion to HE (HDR-enhancer) domain of human CtIP protein and Geminin degron hCas9 Addgene ID 41815
pCas9-CtIP	CtIP (Homo sapiens)		Neomycin (select with G418)	Concordet	CtIP fusion to Cas9 enhances transgene integration by homology-dependent repair. Nat Commun. 2018 Mar 19;9(1):1133. doi: 10.1038/s41467-018-03475-7.	Expresses Cas9 fusion to human CtIP protein hCas9 Addgene ID 41815
pX458_Ruby	hSpCas9			Hublitz	Infection with a Brazilian isolate of Zika virus generates RIG-I stimulatory RNA and the viral NS5 protein blocks type I IFN induction and signaling. Eur J Immunol. 2018 Mar 23. doi: 10.1002/eji.201847483.	Cas9 from S. pyogenes with Ruby2, and cloning backbone for sgRNA PX458
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA	St1Cas9 LMD-9 (Homo sapiens), sgRNA for St1Cas9 (Homo sapiens)	LP1B, hU6		Doyon	Versatile in vivo genome editing with the prototypical Streptococcus thermophilus CRISPR1-Cas9 system bioRxiv	A single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNA pX602 (Plasmid #61593)
MSP1594_2x_NLS	St1Cas9 LMD-9 (Homo sapiens), None (Synthetic)	CAG		Doyon	Versatile in vivo genome editing with the prototypical Streptococcus thermophilus CRISPR1-Cas9 system bioRxiv	Mammalian expression vector for Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) MSP1594 (Plasmid #65775)
U6_sgRNA_CAG_hSt1Cas9_LMD9	St1Cas9 LMD-9 (Homo sapiens), sgRNA for St1Cas9 (Homo sapiens)	CAG, hU6		Doyon	Versatile in vivo genome editing with the prototypical Streptococcus thermophilus CRISPR1-Cas9 system bioRxiv	A single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNA. MSP1594_2x_NLS (Plasmid #110625)
St1Cas9_LMD-9_sgRNA_pUC19	Empty St1Cas9 LMD-9 sgRNA backbone (Homo sapiens)	hU6		Doyon	Versatile in vivo genome editing with the prototypical Streptococcus thermophilus CRISPR1-Cas9 system bioRxiv	U6-driven sgRNA expression plasmid for Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9). pUC19
pLenti-Cas9-P2A-Puro	Cas9 (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vectir for expression of Cas9 in mammalian cells (codon optimized) Adapted from lentiCRISPRv1
pLenti-VQR-P2A-Puro	Cas9-VQR (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VQR (not codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein 3X FLAG (C terminal on insert)
pLenti-VRER-P2A-Puro	Cas9-VRER (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VRER (not codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein 3X FLAG (C terminal on insert)
pLenti-HF1-P2A-Puro	Cas9-HF1 (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-HF1 (not codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein 3X FLAG (C terminal on insert)
pLenti-VQRRA-P2A-Puro	Cas9-VQRRA (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein FLAG (N terminal on insert)
pLenti-VRERRA-P2A-Puro	Cas9-VRERRA (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein FLAG (N terminal on insert)
pLenti-HF1RA-P2A-Puro	Cas9-HF1RA (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-HF1RA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein FLAG (N terminal on insert)
pLenti-VQR-PGK-Puro	Cas9-VQR (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VQR (not codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein 3X FLAG (C terminal on insert)
pLenti-VRER-PGK-Puro	Cas9-VRER (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VRER (not codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein 3X FLAG (C terminal on insert)
pLenti-HF1-PGK-Puro	Cas9-HF1 (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-HF1 (not codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein 3X FLAG (C terminal on insert)
pLenti-VQRRA-PGK-Puro	Cas9-VQRRA (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein FLAG (N terminal on insert)
pLenti-VRERRA-PGK-Puro	Cas9-VRERRA (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein FLAG (N terminal on insert)
pLenti-HF1RA-PGK-Puro	Cas9-HF1RA (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-HF1RA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein FLAG (N terminal on insert)
pLenti-VQR-P2A-GFP-PGK-Puro	Cas9-VQR (Synthetic)	EF1s	Puromycin ; GFP	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VQR-P2A-GFP (not codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein 3X FLAG (C terminal on insert)
pLenti-VRER-P2A-GFP-PGK-Puro	Cas9-VRER (Synthetic)	EF1s	Puromycin ; GFP	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein 3X FLAG (C terminal on insert)
pLenti-HF1-P2A-GFP-PGK-Puro	Cas9-HF1 (Synthetic)	EF1s	Puromycin ; GFP	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-HF1-P2A-GFP (not codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein 3X FLAG (C terminal on insert)
pLenti-VQRRA-P2A-GFP-PGK-Puro	Cas9-VQRRA (Synthetic)	EF1s	Puromycin ; GFP	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VQRRA-P2A-GFP in mammalian cells (codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein FLAG (N terminal on insert)
pLenti-VRERRA-P2A-GFP-PGK-Puro	Cas9-VRERRA (Synthetic)	EF1s	Puromycin ; GFP	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-VRERRA-P2A-GFP in mammalian cells (codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein FLAG (N terminal on insert)
pLenti-HF1RA-P2A-GFP-PGK-Puro	Cas9-HF1RA (Synthetic)	EF1s	Puromycin ; GFP	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of Cas9-HF1RA-P2A-GFP in mammalian cells (codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein FLAG (N terminal on insert)
pLenti-xCas9RA-P2A-Puro	xCas9(3.7)RA (Synthetic)	EF1s	Puromycin	Dow	Optimized base editors enable efficient editing in cells, organoids and mice. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194.	Lentiviral vector for constitutive expression of xCas9(3.7)RA in mammalian cells (codon optimized) Adapted from lentiCRISPRv1 Tag / Fusion Protein FLAG (N terminal on insert)
pEJS654 All-in-One AAV-sgRNA-hNmeCas9	sgRNA scaffold, Human-codon-optimized NmeCas9 (Other)	U6, U1a		Sontheimer	All-in-One Adeno-associated Virus Delivery and Genome Editing by Neisseria meningitidis Cas9 in vivo. bioRxiv, Apr. 4, 2018	Delivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing. PX551-Plasmid #60957
pX458-DsRed2	DsRed2 (Synthetic)			Liang	Speed genome editing by transient CRISPR/Cas9 targeting and large DNA fragment deletion. J Biotechnol. 2018 Jun 7;281:11-20. doi: 10.1016/j.jbiotec.2018.06.308.	Cloning backbone for sgRNA, co-expresses human optimized S. pyogenes Cas9 and DsRed2 pX458
pX458-ECFP	ECFP (Synthetic)			Liang	Speed genome editing by transient CRISPR/Cas9 targeting and large DNA fragment deletion. J Biotechnol. 2018 Jun 7;281:11-20. doi: 10.1016/j.jbiotec.2018.06.308.	Cloning backbone for sgRNA, co-expresses human optimized S. pyogenes Cas9 and ECFP pSpCas9(BB)-2A-GFP (PX458)
pX330 spCas9-mSA	CAS9-MSA (Other)			Rossant	Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166.	pX330 vector carrying spCas9-mSA for gene editing in mammalian cell lines pX330

Bacteria

Plasmid	Gene/Insert	Promoter	PI	Publication	Hidden Extra Search Info
pMJ806	Cas9	T7	Doudna	A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science. 2012 Jun 28.	pEC-K-MBP
pCas9	tracr/Cas9		Marraffini	RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2508.	Bacterial expression of Cas9 nuclease, tracrRNA and crRNA guide pACYC184
pwtCas9-bacteria	wild-type Cas9	pLtetO-1	Qi	Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell. 2013 Feb 28;152(5):1173-83. doi: 10.1016/j.cell.2013.02.022.	aTc-inducible expression of wild-type Cas9 (S .pyogenes) for bacterial gene knockdown pUC19
pET-28b-Cas9-His	Cas9 (Other)		Schier	Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One. 2014 May 29;9(5):e98186. doi: 10.1371/journal.pone.0098186. eCollection 2014.	For in vitro expression and purification of Cas9 protein pET-28b
DS-SPcas	Cas9 (Other), tracrRNA precursor (Other)	proC, tracrRNA promoter	Church	Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.	Bacterial S. pyogenes Cas9 (SP) + tracrRNA expression, cloDF13/spectinomycin cloDF13-aadA
DS-NMcas	Cas9 (Other), NM tracrRNA (Other)	proC, NM tracrRNA promoter	Church	Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.	Bacterial N. meningitidis Cas9 (NM) + tracrRNA expression, cloDF13/spectinomycin cloDF13-aadA
DS-ST1cas	Cas9 (Other), ST1 tracrRNA (Other)	proC	Church	Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.	Bacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycin cloDF13-aadA
DS-TDcas	Cas9 (Other), TD tracrRNA (Other)	proC	Church	Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.	Bacterial T. denticola Cas9 (TD) + tracrRNA expression, cloDF13/spectinomycin cloDF13-aadA
pET28a/Cas9-Cys	Cas9-Cys (Other)	T7 Promoter	Kim	Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA. Genome Res. 2014 Apr 2.	Expresses N-terminal His tag fused human codon-optimized Cas9 nuclease having C-terminal Cysteine pET28a
pCRISPomyces-1	sSpCas9 (Synthetic), tracrRNA (Other), crRNA cassette (Synthetic)	rpsLp(XC)-BbsI, rpsLp(CF), gapdhp(EL)	Zhao	High-Efficiency Multiplex Genome Editing of Streptomyces Species Using an Engineered CRISPR/Cas System. ACS Synth Biol. 2014 Dec 8.	Streptomyces expression of codon-optimized Cas9, tracrRNA, and custom crRNA pKC1139
pCRISPomyces-2	sSpCas9 (Synthetic), gRNA cassette (Synthetic)	rpsL(XC)-BbsI, gapdhp(EL)	Zhao	High-Efficiency Multiplex Genome Editing of Streptomyces Species Using an Engineered CRISPR/Cas System. ACS Synth Biol. 2014 Dec 8.	Streptomyces expression of codon-optimized Cas9 and custom gRNA pKC1139
pCas	cas9 (Other)	native cas9 promoter	Yang	Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14.	Constitutive expression of cas9 and inducible expression of lambda RED and sgR pKD46
pET-(-30)dGFP-9xGGS-Cath-NLS-Cas9-6xHis	(pos36)dGFP-9xGGS-Cath-NLS-Cas9-6xHis (Other)	T7	Liu	Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2015 Jan;33(1):73-80. doi: 10.1038/nbt.3081. Epub 2014 Oct 30.	Expression of (pos36)dGFP-9xGGS-Cath-NLS-Cas9-6xHis in bacterial cells pET29
pET-Cas9-6xHis	Cas9_6xHis (Other)	T7	Liu	Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2015 Jan;33(1):73-80. doi: 10.1038/nbt.3081. Epub 2014 Oct 30.	Expression of Cas9-6xHis in bacterial cells pET29
pTrex-b-NLS-hSpCas9	NLS-hSpCas9	Ribo-HX1	Tarleton	CRISPR-Cas9-Mediated Single-Gene and Gene Family Disruption in Trypanosoma cruzi. MBio. 2014 Dec 30;6(1). pii: e02097-14. doi: 10.1128/mBio.02097-14.	Expression of Cas9 in T. cruzi pTrex-b
pKCcas9dO	Scocas9 (Other), sgRNA (), act-orf4 homology arm	ptipA, j23119	Jiang	One-step high-efficiency CRISPR/Cas9-mediated genome editing in Streptomyces. Acta Biochim Biophys Sin (Shanghai). 2015 Apr;47(4):231-43. doi: 10.1093/abbs/gmv007. Epub 2015 Mar 3.	High efficiency Streptomyces genome editing by CRISPR/Cas9 system pKC1139
pCas9-CR4	Cas9 nuclease		Prather	The no-SCAR (Scarless Cas9 Assisted Recombineering) system for genome editing in Escherichia coli. Sci Rep. 2015 Oct 14;5:15096. doi: 10.1038/srep15096.	Cas9 nuclease under control of pTet promoter with ssrA tag and constitutive tetR pdCas9-bacteria
SP-Cas9	SP-CAS9 (Other)	T7	Geijsen	Efficient Intracellular Delivery of Native Proteins. Cell. 2015 Apr 23;161(3):674-690. doi: 10.1016/j.cell.2015.03.028.	Expresses SP-Cas9 protein in bacterial cells pET-15
pCMK	Cas9 (Synthetic)		Rodrigue	Bacterial constitutive gRNA expression plasmid (unpublished)	Bacterial constitutive S. pyogenes Cas9 expression plasmid pCMK
pET-Cas9-NLS-6xHis	Cas9-NLS-6xHis (Other)	T7	Liu	Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2015 Jan;33(1):73-80. doi: 10.1038/nbt.3081. Epub 2014 Oct 30.	Expression of Cas9-NLS-6xHis in bacterial cells pET29
pET-NLS-Cas9-6xHis	NLS-Cas9-6xHis (Other)	T7	Liu	Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2015 Jan;33(1):73-80. doi: 10.1038/nbt.3081. Epub 2014 Oct 30.	Expression of NLS-Cas9-6xHis in bacterial cells pET29
pLPhygCAS9	Humanized Streptococcus pyogenes Cas9 from PX330 (Addgene) (Other)		Matlashewski	CRISPR-Cas9-Mediated Genome Editing in Leishmania donovani. MBio. 2015 Jul 21;6(4). pii: e00861-15. doi: 10.1128/mBio.00861-15.	Expresses CAS9 in Leishmania pLPHyg2
pYTK036	Cas9 (Other)		Dueber	A Highly-characterized Yeast Toolkit for Modular, Multi-part Assembly. ACS Synth Biol. 2015 Apr 14.	Encodes Cas9 as a Type 3 part to be used in the Dueber YTK system pYTK001
BPK764	mammalian codon-optimized Streptococcus pyogenes Cas9-NLS-3XFlag, and SpCas9 gRNA (Other)	T7 (x2)	Joung	Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592.	Bacterial expression plasmid for SpCas9 & sgRNA (need to clone spacer into BsaI sites): T7-humanSpCas9-NLS-3xFLAG-T7-BsaIcassette-Sp-sgRNA pACYCDuet-1 Tags / Fusion Proteins NLS (C terminal on insert) 3x FLAG (C terminal on insert)
MSP1673	mammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS, and St1Cas9 gRNA (Other)	T7 (x2)	Joung	Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592.	Bacterial expression plasmid for S. thermophilus1 Cas9 & sgRNA (need to clone in spacer into BspMI sites): T7-humanSt1Cas9-NLS-T7-BspMIcassette-St1-sgRNA pACYCDuet-1 Tag / Fusion Protein NLS (C terminal on insert)
BPK2101	mammalian codon-optimized Staphylococcus aureus Cas9-NLS-3xFlag, and SaCas9 gRNA (Other)	T7 (x2)	Joung	Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592.	Bacterial expression plasmid for S. aureus Cas9 & sgRNA (need to clone in spacer into BsaI sites): T7-humanSaCas9-NLS-3xFLAG-T7-BsaIcassette-Sa-sgRNA pACYCDuet-1 Tags / Fusion Proteins NLS (C terminal on insert) 3x FLAG (C terminal on insert)
pHO4d-Cas9	Cas9 (Other)	T7	Nonet	Landscape of target:guide homology effects on Cas9-mediated cleavage. Nucleic Acids Res. 2014 Dec 16;42(22):13778-87. doi: 10.1093/nar/gku1102. Epub 2014 Nov 15.	Cas9nlsHis6 Bacterial Expression construct pHO4D
pMJ915	cas9 (Other)	T7	Doudna	Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery. Elife. 2014 Dec 15;3:e04766. doi: 10.7554/eLife.04766.	Express Streptococcus pyogenes Cas9 carrying two C-terminal SV40 NLS pML-2CT
MSP2283	mammalian codon-optimized Staphylococcus aureus Cas9-NLS-3xFlag (Other), SaCas9 sgRNA (+84)	T7, T7	Joung	Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. 2015 Nov 2. doi: 10.1038/nbt.3404.	Bacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1 pACYCDuet-1
MSP2253	mammalian codon-optimized KKH variant Staphylococcus aureus Cas9(E782K/N968K/R1015H)-NLS-3xFlag (Other), SaCas9 sgRNA (+84)	T7, T7	Joung	Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. 2015 Nov 2. doi: 10.1038/nbt.3404.	Bacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #1 pACYCDuet-1
MSP2266	mammalian codon-optimized Staphylococcus aureus Cas9-NLS-3xFlag (Other), SaCas9 sgRNA (+84)	T7, T7	Joung	Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. 2015 Nov 2. doi: 10.1038/nbt.3404.	Bacterial expression plasmid for SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2 pACYCDuet-1
MSP2292	mammalian codon-optimized KKH variant Staphylococcus aureus Cas9(E782K/N968K/R1015H)-NLS-3xFlag, and SaCas9 sgRNA(84) (Other), SaCas9 sgRNA (+84)	T7, T7	Joung	Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. 2015 Nov 2. doi: 10.1038/nbt.3404.	Bacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #2 pACYCDuet-1
pCas9_sgRNA_0	U6 promoter (Other), cas9 (Synthetic), tnos terminator (Other)	U6 from Ustilago maydis, synthetic otef promoter (Spellig et al., 1996, Mol. Gen. Genet. 252)	Kahmann	Genome editing in Ustilago maydis using the CRISPR-Cas system. Fungal Genet Biol. 2015 Sep 11. pii: S1087-1845(15)30025-6. doi: 10.1016/j.fgb.2015.09.001.	expresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicating pNEBUC
pMCSG7-Wt-NmeCas9	pMCSG7-WT-NmeCas9 (Other)		Sontheimer	DNase H Activity of Neisseria meningitidis Cas9. Mol Cell. 2015 Oct 15;60(2):242-55. doi: 10.1016/j.molcel.2015.09.020.	bacterial pMCSG7 expression vector expressing Wildtype Nme cas9 with T7 promoter, N-terminal His tag and TEV site pMCSG7
pCas9cur	Cas9 (Other), Plasmid curing system	pBAD	Chen	Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metab Eng. 2015 Sep;31:13-21. doi: 10.1016/j.ymben.2015.06.006. Epub 2015 Jun 30.	Constitutive expression of Cas9 gene and inducible expression of the plasmid curing system for CRISPR mediated genome editing of E. coli. pSC101ts
pREDCas9	Cas9 (Other), lambda red genes, plasmid curing system	pBAD	Chen	Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metab Eng. 2015 Sep;31:13-21. doi: 10.1016/j.ymben.2015.06.006. Epub 2015 Jun 30.	Constitutive expression of Cas9, inducible expression of the Red recombineering system, and inducible expression of the plasmid curing system for CRISPR mediated genome editing of E. coli. pSC101ts
pCAS1yl	Cas9 (Other), sgRNA (Synthetic)	unknown	Yang	Multiplex gene editing of the Yarrowia lipolytica genome using the CRISPR-Cas9 system. J Ind Microbiol Biotechnol. 2016 Aug;43(8):1085-93. doi: 10.1007/s10295-016-1789-8. Epub 2016 Jun 27.	Constitutive expression of Cas9 and sgRNA in Yarrowia lipolytica cells pMCSCen1
pMA7CR_2.0	cas9 (Other), lambda beta (Other), dam (Other), recX (Other)	pTet, pAra, pAra, pTet	Nielsen	CRMAGE: CRISPR Optimized MAGE Recombineering. Sci Rep. 2016 Jan 22;6:19452. doi: 10.1038/srep19452.	pMA7CR_2.0 contains arabinose inducible λ/RED β-protein and dam, and aTc inducible CRISPR/Cas9 and recX pBAD24
pDEST-hisMBP-AsCpf1-EC	AsCpf1 (Synthetic)	tac promoter	Kim	Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nat Biotechnol. 2016 Jun 6. doi: 10.1038/nbt.3596.	Expressing his-MBP tagged AsCpf1 (E.coli codon optimized) pDEST-hisMBP
pMAL-his-LbCpf1-EC	LbCpf1 (Synthetic)	tac promoter	Kim	Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nat Biotechnol. 2016 Jun 6. doi: 10.1038/nbt.3609.	Bacterial expression - MBP-his tagged LbCpf1 (E.coli codon optimized) pMAL-c5X
pCas9-CAT	Cas9 (Other), Chloramphenicol acetyltransferase	TgTUB1, TgTUB1	Lourido	A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2.	Encodes Cas9 and chloramphenicol acetyltransferase (CAT) pU6-Universal
pU6-Decoy	Decoy sgRNA	U6	Lourido	A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2.	Encodes Cas9 and a CRISPR sgRNA that alleviates toxicity to Cas9 in Toxoplasma gondii pU6-Universal
pEC-K-CBP_CjeCas9	CjeCas9 (Other)		Doudna	Single-Stranded DNA Cleavage by Divergent CRISPR-Cas9 Enzymes. Mol Cell. 2015 Nov 5;60(3):398-407. doi: 10.1016/j.molcel.2015.10.030.	Expresses Campylobacter jejuni Cas9 (Cje Cas9). pEC-K
p2CT-Cdi	CdiCas9		Doudna	Single-Stranded DNA Cleavage by Divergent CRISPR-Cas9 Enzymes. Mol Cell. 2015 Nov 5;60(3):398-407. doi: 10.1016/j.molcel.2015.10.030.	Expresses Corynebacterium diphtheriae Cas9 (CdiCas9) PET
pLdCN	gRNA and Cas9 (Other)	L. donovani ribosome RNA promoter	Matlashewski	Optimized CRISPR-Cas9 Genome Editing for Leishmania and Its Use To Target a Multigene Family, Induce Chromosomal Translocation, and Study DNA Break Repair Mechanisms. mSphere. 2017 Jan 18;2(1). pii: e00340-16. doi: 10.1128/mSphere.00340-16. eCollection 2017 Jan-Feb.	Express gRNA and Cas9 in Leishmania with Neomycin resistance pSP72
pLdCH	gRNA and Cas9 (Other)	L. donovani ribosome RNA promoter	Matlashewski	Optimized CRISPR-Cas9 Genome Editing for Leishmania and Its Use To Target a Multigene Family, Induce Chromosomal Translocation, and Study DNA Break Repair Mechanisms. mSphere. 2017 Jan 18;2(1). pii: e00340-16. doi: 10.1128/mSphere.00340-16. eCollection 2017 Jan-Feb.	Express gRNA and Cas9 in Leishmania with Hygromycin resistance pSP72
pJYS3_ΔcrtYf	Cpf1 (Other), crRNA of crtYf (Synthetic)		Yang	CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179.	Constitutive transcription of FnCpf1 and crRNA of crtYf pXMJ19
pJYS1Ptac	Cpf1 (Other), recT (Other)	tac, unknown	Yang	CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179.	Constitutive trancription of FnCpf1 and recT in C.glutamitum, tac promoter pXMJ19
pJYS1Peftu	Cpf1 (Other), recT (Other)	etfu, unknown	Yang	CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179.	Constitutive expression of FnCpf1 and recT in C.glutamitum, etfu promoter pXMJ19
pX2-Cas9	Cas9 (Other)	pBAD	Gill	pX2-Cas9 (unpublished)	Arabinose inducible Cas9 in a broad host range backbone. pBTBX-2
pSHS212	Cas9 (Other)	T7	Doudna	Conformational control of DNA target cleavage by CRISPR-Cas9. Nature. 2015 Nov 5;527(7576):110-3. doi: 10.1038/nature15544. Epub 2015 Oct 28.	Cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid pCT10
pSHS293	Cas9 (Other)	T7	Doudna	Conformational control of DNA target cleavage by CRISPR-Cas9. Nature. 2015 Nov 5;527(7576):110-3. doi: 10.1038/nature15544. Epub 2015 Oct 28.	D435C/E945C in cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid, lobe closure FRET construct pCT10
pSHS306 - Bacterial expression plasmid for SpCas9, HNH FRET variant	Cas9 (Other)	T7	Doudna	Conformational control of DNA target cleavage by CRISPR-Cas9. Nature. 2015 Nov 5;527(7576):110-3. doi: 10.1038/nature15544. Epub 2015 Oct 28.	S867C/S355C in cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid, HNH-1 FRET construct pCT10
pSHS248	Cas9 (Other)	T7	Doudna	Conformational control of DNA target cleavage by CRISPR-Cas9. Nature. 2015 Nov 5;527(7576):110-3. doi: 10.1038/nature15544. Epub 2015 Oct 28.	S867C/N1054C in cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid, HNH-2 FRET construct pCT10
pET-MBP-Geo_st	GeoCas9 (Other)		Doudna	GeoCas9 Plasmids (unpublished)	Expression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP pET
pET-MBP-NLS-Geo_st	GeoCas9 (Other)		Doudna	GeoCas9 Plasmids (unpublished)	Expression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP and SV40 NLS pET
pFC330	Cas9 (Synthetic), pyrG (Other)	Aspergillus nidulans tef1 promoter, native promoter	Mortensen	A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. PLoS One. 2015 Jul 15;10(7):e0133085. doi: 10.1371/journal.pone.0133085. eCollection 2015.	AMA1 plasmid with Aspergillus optimized Cas9 and pyrG selection marker custom
pFC331	Cas9 (Synthetic), argB (Other)	Aspergillus nidulans tef1 promoter, native promoter	Mortensen	A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. PLoS One. 2015 Jul 15;10(7):e0133085. doi: 10.1371/journal.pone.0133085. eCollection 2015.	AMA1 plasmid with Aspergillus optimized Cas9 and argB selection marker custom
pFC333	Cas9 (Synthetic), ble (bleomycin resistance marker) (Other)	Aspergillus nidulans tef1 promoter, Aspergillus nidulans trpC promoter	Mortensen	A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. PLoS One. 2015 Jul 15;10(7):e0133085. doi: 10.1371/journal.pone.0133085. eCollection 2015.	AMA1 plasmid with Aspergillus optimized Cas9 and ble selection marker custom
pFC332	Cas9 (Synthetic), hph (hygromycin resistance marker) (Other)	Aspergillus nidulans tef1 promoter, Aspergillus nidulans trpC promoter	Mortensen	A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. PLoS One. 2015 Jul 15;10(7):e0133085. doi: 10.1371/journal.pone.0133085. eCollection 2015.	AMA1 plasmid with Aspergillus optimized Cas9 and hph selection marker custom
pMJ915v2+Nterm Spe1 +Cterm Age1 site			Doudna	Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806.	For expression of modified SpyCas9 in e.coli. pMJ915
1xNLS-pMJ915v2	Cas9		Doudna	Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806.	For expression of modified SpyCas9 in e.coli. pMJ915
2xNLS-pMJ915v2	Cas9, T7		Doudna	Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806.	For expression of modified SpyCas9 in e.coli. pMJ915
4xNLS-pMJ915v2	Cas9, T7		Doudna	Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806.	For expression of modified SpyCas9 in e.coli. pMJ915
pMJ915v2 + sfGFP	Cas9, T7		Doudna	Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806.	For expression of modified SpyCas9 in e.coli. pMJ915
1xNLS-pMJ915v2-sfGFP	Cas9, T7		Doudna	Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806.	For expression of modified SpyCas9 in e.coli. pMJ915
2xNLS-pMJ915v2-sfGFP	Cas9, T7		Doudna	Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806.	For expression of modified SpyCas9 in e.coli. pMJ915
4xNLS-pMJ915v2-sfGFP	Cas9, T7		Doudna	Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806.	For expression of modified SpyCas9 in e.coli. pMJ915
7xNLS-pMJ915v2-sfGFP	Cas9, T7		Doudna	Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017 Feb 13. doi: 10.1038/nbt.3806.	For expression of modified SpyCas9 in e.coli. pMJ915
pET-CjCas9	CjCas9 (Other)	T7	Kim	In vivo genome editing with a small Cas9 orthologue derived from Campylobacter jejuni. Nat Commun. 2017 Feb 21;8:14500. doi: 10.1038/ncomms14500.	Expression of CjCas9 with His tag in E.coli pET28b
pEM-Cas9HF1	Cas9HF1 (Other)	pTet	Lynch	Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.	Modified from pCas9-CR4 (Addgene: 62655) to use the high-fidelity version of Cas9, SpCas9-HF1 (N497A/R661A/Q695A/Q926A) from Kleinstiver et al 2016. pCas9-CR4
pEM-Cas9HF1-recA56	Cas9HF1 (Other), recA56 (Other)	pTet, proD	Lynch	Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.	Modified from pEM-Cas9HF1 (Addgene ID: 89961) to include constitutive recA56 to block recA-mediated double-strand break repair. pEM-Cas9HF1
6-His-MBP-TEV-FnCpf1	FnCpf1 (humanized) (Other)	T7	Zhang	Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038.	Bacterial expression plasmid for protein purification pET-28
6His-MBP-TEV-huAsCpf1	huAsCpf1 (Other)		Zhang	Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.	Bacterial expression plasmid for protein purification pET-28
6His-MBP-TEV-huLbCpf1	huLbCpf1 (Other)		Zhang	Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.	Bacterial expression plasmid for protein purification pET-28
pMST665_BB3_L 23_gRNAempty_cas9_BbsI	Cas9		Sauer	An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30643-0. doi: 10.1016/j.biortech.2017.05.004.	BB3_L 23_gRNAempty_cas9_BbsI; CRISPR plasmid with empty gRNA spacer to incorporate gRNA, Cas9 BB3_AMA_2.8_pUC-ORI_L_AC_hph
pFREE	Cas9, gRNA array (Synthetic)	ptet, pRhamBAD	Norholm	A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z.	Allows inducible expression of gRNAs and Cas9 for plasmid curing. pMAZ-SK
pFREE_Amp	Cas9, gRNA array (Synthetic)	ptet, pRhamBAD	Norholm	A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z.	Allows inducible expression of gRNAs and Cas9 for plasmid curing. pMAZ-SK
pFREE_Cm	Cas9, gRNA array (Synthetic)	ptet, pRhamBAD	Norholm	A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z.	Allows inducible expression of gRNAs and Cas9 for plasmid curing. pMAZ-SK
pFREE_Zeo	Cas9, gRNA array (Synthetic)	ptet, pRhamBAD	Norholm	A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z.	Allows inducible expression of gRNAs and Cas9 for plasmid curing. pMAZ-SK
pFREE-RK2	Cas9, gRNA array (Synthetic)	ptet, pRhamBAD	Norholm	A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z.	Allows inducible expression of gRNAs and Cas9 for plasmid curing as well as self-curing via a temperature sensitive RK2 replicon. pMAZ-SK
pLQ-Pxyl/tet-cas9-Pj23119-sgRNA	Cas9-Pxyltet-sgRNA-pj23119 (Other)		Yang	Sheng lab CRISPR plasmids (unpublished)	CRISPR-Cas9 based efficient genome editing in S. aureus unknown
pLQ-kO-tgt	Cas9-Pxyltet-sgRNA-Pspou-donor-tgt (Other)		Yang	Sheng lab CRISPR plasmids (unpublished)	CRISPR-Cas9 based efficient genome editing in S. aureus unknown
pET28a-Cas9-His	NLS-Cas9-NLS (Other)	T7	Gao	Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nat Commun. 2017 Jan 18;8:14261. doi: 10.1038/ncomms14261.	Purification of Cas9 protein pET28a (+)
p46Cpf1-OP2	FnCpf1 (Other)	araBAD	Wu	Qiong Wu CRISPR plasmids (unpublished)	Produces lambda Red and Cpf1 for recombination and selection. The plasmid is combined with a donor plasmid (with crRNA and template) for rapid genome editing in E.coli. pKD46
pJWV102-wtcas9sp	cas9sp (Synthetic)	PczcD	Kjos	Chromosome segregation drives division site selection in Streptococcus pneumoniae. Proc Natl Acad Sci U S A. 2017 Jul 3. pii: 201620608. doi: 10.1073/pnas.1620608114.	Plasmid containing wild-type cas9sp pJWV102
pThermoCas9_ctrl	Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain (Other), ThermoCas9 single guide RNA expressing module (Other)	B. smithii xylL promoter, B. coagulans DSM 1 pta promoter	van der Oost	Characterizing a thermostable Cas9 for bacterial genome editing and silencing. Nat Commun. 2017 Nov 21;8(1):1647. doi: 10.1038/s41467-017-01591-4.	Expresses ThermoCas9 and its sgRNA module pNW33n
SpyCas9(WT)	SpyCas9 (Synthetic)		Huang	Structural basis of CRISPR-SpyCas9 inhibition by an anti-CRISPR protein. Nature. 2017 Jun 15;546(7658):436-439. doi: 10.1038/nature22377. Epub 2017 Apr 27.	Express Streptococcus pyogenes Cas9 pGEX-6P-1 Tag / Fusion Protein GST (N terminal on backbone)
p6XHis_NLS-SaCas9	CRISPR-associated protein Cas9/Csn1 [Staphylococcus aureus subsp. aureus] (Other)	T7lac	Tarleton	Rapid, Selection-Free, High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins. MBio. 2017 Nov 7;8(6). pii: e01788-17. doi: 10.1128/mBio.01788-17.	Express SaCas9 in bacteria with a 6xHis tag for purification pET-32 EK/LIC
pSHS207 - Bacterial expression plasmid for WT SpCas9	SpCas9 (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for WT SpCas9 pCT10
pJSC033 - Bacterial expression plasmid for SpCas9, REC2 FRET variant	SpCas9 variant C80S/C574S/E60C/D273C (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9, REC2 FRET variant pCT10
pJSC052 - Bacterial expression plasmid for SpCas9, REC3 FRET variant	SpCas9 variant C80S/C574S/S701C/S960C (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9, REC3 FRET variant pCT10
pSHS273 - Bacterial expression plasmid for SpCas9∆REC3 variant	SpCas9 variant M1–N497,GGS,V713–D1368 (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9∆REC3 variant pCT10
pJSC038 - Bacterial expression plasmid for SpCas9∆REC3, HNH FRET variant	SpCas9 variant C80S/C574S/S355C/S867C/M1–N497,GGS,V713–D1368 (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9∆REC3, HNH FRET variant pCT10
pJSC057 - Bacterial expression plasmid for SpCas9∆REC3, REC2 FRET variant	SpCas9 variant C80S/C574S/E60C/D273C/M1–N497,GGS,V713–D1368 (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9∆REC3, REC2 FRET variant pCT10
pSHS325 - Bacterial expression plasmid for SpCas9 REC3 domain	SpCas9 variant K506–Q712 (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 REC3 domain pCT10
pJSC176 - Bacterial expression plasmid for SpCas9 + Q926A variant	SpCas9 variant Q926A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 + Q926A variant pCT10
pJSC119 - Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A variant	SpCas9 variant N497A/R661A/Q695A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A variant pCT10
pJSC120 - Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variant	SpCas9 variant C80S/C574S/S355C/S867C/N497A/R661A/Q695A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variant pCT10
pJSC111 - Bacterial expression plasmid for SpCas9-HF1 variant	SpCas9 variant N497A/R661A/Q695A/Q926A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9-HF1 variant pCT10
pJSC115 - Bacterial expression plasmid for SpCas9-HF1, HNH FRET variant	SpCas9 variant C80S/C574S/S355C/S867C/N497A/R661A/Q695A/Q926A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9-HF1, HNH FRET variant pCT10
pJSC129 - Bacterial expression plasmid for SpCas9-HF1, REC2 FRET variant	SpCas9 variant C80S/C574S/E60C/D273C/N497A/R661A/Q695A/Q926A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9-HF1, REC2 FRET variant pCT10
pJSC131 - Bacterial expression plasmid for SpCas9-HF1, REC3 FRET variant	SpCas9 variant C80S/C574S/S701C/S960C/N497A/R661A/Q695A/Q926A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9-HF1, REC3 FRET variant pCT10
pJSC090 - Bacterial expression plasmid for SpCas9 + K855A variant	SpCas9 variant K855A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 + K855A variant pCT10
pJSC077 - Bacterial expression plasmid for SpCas9 + K855A, HNH FRET variant	SpCas9 variant C80S/C574S/S355C/S867C/K855A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 + K855A, HNH FRET variant pCT10
pJSC114 - Bacterial expression plasmid for SpCas9 eSpCas9(1.1) variant	SpCas9 variant K848A/K1003A/R1060A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 eSpCas9(1.1) variant pCT10
pJSC270 - Bacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant	SpCas9 variant K848A/K1003A/R1060A/N497A/R661A/Q695A/Q926A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant pCT10
pJSC173 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9) variant	SpCas9 variant N692A/M694A/Q695A/H698A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9) variant pCT10
pJSC269 - Bacterial expression plasmid for SpCas9 Cluster 1 + Q926A variant	SpCas9 variant N692A/M694A/Q695A/H698A/Q926A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 Cluster 1 + Q926A variant pCT10
pJSC011 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variant	SpCas9 variant C80S/C574S/S355C/S867C/N692A/M694A/Q695A/H698A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variant pCT10
pJSC281 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC2 FRET variant	SpCas9 variant C80S/C574S/E60C/D273C/N692A/M694A/Q695A/H698A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC2 FRET variant pCT10
pJSC282 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variant	SpCas9 variant C80S/C574S/S701C/S960C/N692A/M694A/Q695A/H698A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variant pCT10
pJSC197 - Bacterial expression plasmid for SpCas9 Cluster 2 + Q926A variant	SpCas9 variant G528A/V583A/E584A/D585A/N588A/Q926A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 Cluster 2 + Q926A variant pCT10
pJSC228 - Bacterial expression plasmid for SpCas9 Cluster 2 variant	SpCas9 variant G582A/V583A/E584A/D585A/N588A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 Cluster 2 variant pCT10
pJSC239 - Bacterial expression plasmid for SpCas9 Cluster 3 + Q926A variant	SpCas9 variant T657A/G658A/W659A/R661A/Q926A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 Cluster 3 + Q926A variant pCT10
pJSC236 - Bacterial expression plasmid for SpCas9 Cluster 4 + Q926A variant	SpCas9 variant F491A/M495A/T496A/N497A/Q926A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 Cluster 4 + Q926A variant pCT10
pJSC272 - Bacterial expression plasmid for SpCas9 Cluster 5 + Q926A variant	SpCas9 variant K918A/V922A/R925A/Q926A (Other)	T7	Doudna	Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268.	Bacterial expression plasmid for SpCas9 Cluster 5 + Q926A variant pCT10
pEM-Cas9noSsrA	Cas9 (Other)	pTet	Lynch	Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.	Modified from pCas9-CR4 (Addgene: 62655) to remove the ssrA tag from Cas9. pCas9-CR4
pEM-Cas9HF1-indRecA56	Cas9HF1 (Other), recA56	pTet, pTet	Lynch	Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.	Modified from pEM-Cas9HF1 (Addgene ID: 89961) to co-express inducible recA56 to block recA-mediated double-strand break repair. pEM-Cas9HF1
AsCpf1-2NLS	AsCpf1-6xHis-MBP-TEV (Synthetic)	T7	Doudna	CRISPR-Cpf1 mediates efficient homology-directed repair and temperature-controlled genome editing. Nat Commun. 2017 Dec 8;8(1):2024. doi: 10.1038/s41467-017-01836-2.	bacterial expression of AsCpf1-2NLS pET
LbCpf1-2NLS	LbCpf1 (Synthetic)	T7	Doudna	CRISPR-Cpf1 mediates efficient homology-directed repair and temperature-controlled genome editing. Nat Commun. 2017 Dec 8;8(1):2024. doi: 10.1038/s41467-017-01836-2.	bacterial expression of LbCpf1-2NLS pET
pSBY1_FnCpf1cg	FnCpf1 (Other)	hsp60	Yang	Yang Lab CRISPR plasmids (unpublished)	CRISPR system used to genome editing in Mycobacterium smegmatis, expresses Fn CPf1 pMV261
pJK02	Upstream & Downstream pyrE deletion region (Other), tetR, Cas9 (Other), gRNA		Sorg	Using CRISPR-Cas9-mediated genome editing to generate C. difficile mutants defective in selenoproteins synthesis. Sci Rep. 2017 Nov 7;7(1):14672. doi: 10.1038/s41598-017-15236-5.	Clostridium difficile CRISPR-cas9 mutagenesis plasmid traJ oriT pMTL84151
pKM126	Upstream & Downstream pyrE deletion region (Other), tetR, Cas9 (Other), gRNA		Sorg	Using CRISPR-Cas9-mediated genome editing to generate C. difficile mutants defective in selenoproteins synthesis. Sci Rep. 2017 Nov 7;7(1):14672. doi: 10.1038/s41598-017-15236-5.	Clostridium difficile CRISPR-cas9 mutagenesis plasmid Tn916 oriT pJS116
pCas9	cas9 (Other), Lambda red genes (Other)	J23105, araBAD	Pfleger	Genetic tools for reliable gene expression and recombineering in Pseudomonas putida. J Ind Microbiol Biotechnol. 2018 Jan 3. pii: 10.1007/s10295-017-2001-5. doi: 10.1007/s10295-017-2001-5.	Recombineering plasmid with constitutively expressed cas9 and the araBAD promoter expressing αβγ pSEVA224
pCAS9counter	Cas9, sgRNA	prab17, prab17	Salipante	Efficient and Scalable Precision Genome Editing in Staphylococcus aureus through Conditional Recombineering and CRISPR/Cas9-Mediated Counterselection. MBio. 2018 Feb 20;9(1). pii: mBio.00067-18. doi: 10.1128/mBio.00067-18.	Expresses CAS9 and sgRNA for targeted counterselection in S. aureus pCN-50
pET28b-NmCas9-Flag	CRISPR-associated endonuclease Cas9 (Other)	T7	Zhang	Programmable RNA Cleavage and Recognition by a Natural CRISPR-Cas9 System from Neisseria meningitidis. Mol Cell. 2018 Mar 1;69(5):906-914.e4. doi: 10.1016/j.molcel.2018.01.025. Epub 2018 Feb 15.	Wild type Cas9 from Nm8013 cloned into pET28b with a C-terminal Flag tag for protein expression pET28b
pxCas9CR4	TetR and xCas9 (Synthetic)		Reisch	pCas9CR4 with point mutations from Cas9X for NG PAM sites (unpublished)	PCas9CR4 with the xCas9 mutations allowing NG PAM sites p15A origin
pRPaCas9	Cas9 (Other)		Horn	Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes. Sci Rep. 2018 May 21;8(1):7960. doi: 10.1038/s41598-018-26303-w.	Expresses Cas9 in T. brucei (2T1) cells pUC
pNS20-SpCas9-SNAP	Cas9 (Other)		Schwank	Covalent linkage of the DNA repair template to the CRISPR-Cas9 nuclease enhances homology-directed repair. Elife. 2018 May 29;7. pii: 33761. doi: 10.7554/eLife.33761.	Bacterial vector for expression of Snap-tagged Streptococcus pyogenes Cas9 pET His6 MBP N10 TEV LIC cloning vector (2C-T)

Drosophila

Plasmid	Gene/Insert	Promoter	Selectable Marker	PI	Publication	Hidden Extra Search Info
pHsp70-Cas9	Codon optimized Cas9			O'Connor-Giles	Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics. 2013 May 24.	The codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter used in Gratz, et al. (2013). Plasmid is low copy number. pHSS6
pBS-Hsp70-Cas9	codon optimized Cas9	Hsp70		O'Connor-Giles	FlyCRISPR (unpublished)	A codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter. pBluescript-KS(+)
pAc-sgRNA-Cas9	Cas9 (Synthetic), dU6-sgRNA (Drosophila melanogaster)	Actin-5c, Drosophila U6	Puromycin	Liu	Mutagenesis and homologous recombination in Drosophila cell lines using CRISPR/Cas9. Biol Open. 2013 Dec 10. pii: bio.20137120v1. doi: 10.1242/bio.20137120.	Expresses sgRNA and Cas9-Puro in Drosophila S2 cells pAc-STABLE1-Puro
pRB14	S. pyogenes cas9 with humanized codon bias (Other)	tubulin		Foerstemann	Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination donors in cultured Drosophila cells. Nucleic Acids Res. 2014 Apr 19.	expresses a myc-tagged version of hCas9 in Drosophila pCASPER5
pDCC6	Cas9 (Synthetic), U6-2>sgRNA (Synthetic)	hsp70Bb, U6-96Ab		Duchek	Efficient CRISPR/Cas9 Plasmids for Rapid and Versatile Genome Editing in Drosophila. G3 (Bethesda). 2014 Sep 17. pii: g3.114.014126. doi: 10.1534/g3.114.014126.	Bi-cistronic Drosophila CRISPR/Cas9 vector, contains hsp70>Cas9 and U6>sgRNA cassette pHW
pnos-Cas9-nos	cas9	nanos		Bullock	Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500.	Expresses Cas9 under control of nanos promoter and 3'UTR. For germ line restricted genome engineering in Drosophila melanogaster. pnos
pAct-Cas9	cas9	act5C		Bullock	Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500.	Expresses Cas9 under control of act5C promoter and SV40 3'UTR. For ubiquitous genome engineering in Drosophila melanogaster. pact
p(bhsp68-Cas9)	Cas9 (Other)	bhsp		Averof	Efficient CRISPR-mediated gene targeting and transgene replacement in the beetle Tribolium castaneum. Development. 2015 Jul 9. pii: dev.125054.	Tribolium basal heat shock promoter driving Cas9 pSLfa[Tc-bhsp68::nlsEGFP]fa
act-AsCpf1	hAsCpf1 (Homo sapiens)	act5C		Bullock	Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nat Methods. 2016 Oct;13(10):852-4. doi: 10.1038/nmeth.3972. Epub 2016 Sep 5.	expression plasmid of AsCpf1 pact

Plant

Plasmid	Gene/Insert	Promoter	Selectable Marker	PI	Publication	Hidden Extra Search Info
pK7WGF2::hCas9	hCas9 (Synthetic)	35S	Kanamycin	Kamoun	Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655.	Expesses the human codon usage Cas9 nuclease (Mali et al. Science 339, 823-826, 2013) with an N-terminal GFP tag from the 35S promoter in the plant tissue pK7WGF2
pICH41308::hCas9	hCas9 (Synthetic)			Kamoun	Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 2013 Oct 11;9(1):39.	Level 0 hCas9 module pICH41308
pICH47742::2x35S-5’UTR-hCas9(STOP)-NOST	35Sp::hCas9 (Synthetic)			Kamoun	Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 2013 Oct 11;9(1):39.	Level 1 hCas9 module pICH47742
pAGM4723::AtU6p::sgRNA2-2x35S-5′UTR::Cas9::NOST-AtU6p::sgRNA1	sgRNA_PDS2-Cas9-sgRNA_PDS1 (Synthetic)			Kamoun	Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 2013 Oct 11;9(1):39.	Level 2 construct pAGM4723
pBUN411	3×FLAG-NLS-zCas9-NLS (Synthetic), gRNA scaffold (Synthetic)	Ubi1p, OsU3p	Bar	Chen	A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327.	CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistance pGreen-like binary vector
pHSN401	3×FLAG-NLS-zCas9-NLS (Synthetic), gRNA scaffold (Synthetic)	2×35Sp, AtU6-26p	Hygromycin	Chen	A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327.	CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistance pGreen-like binary vector
pRGE31		Rice snoRNA U3 and dual 35S promoter		Yang	RNA-Guided Genome Editing in Plants Using a CRISPR-Cas System. Mol Plant. 2013 Nov;6(6):1975-83. doi: 10.1093/mp/sst119. Epub 2013 Aug 17.	Expressing sgRNA and Cas9 in plants. The sgRNA was controlled by rice snoRNA U3 promoter pUGW11
pRGEB31		Rice snoRNA U3 and dual 35S promoter	Hygromycin	Yang	RNA-Guided Genome Editing in Plants Using a CRISPR-Cas System. Mol Plant. 2013 Nov;6(6):1975-83. doi: 10.1093/mp/sst119. Epub 2013 Aug 17.	Binary vector derived from pRGE31. Deliver sgRNA and Cas9 into plant. by agrobacterium mediated transformation. pCAMBIA1300
HBT-pcoCas9	pcoCas9 (Synthetic)	hybrid constitutive promoter 35SPPDK		Sheen	Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol. 2013 Aug;31(8):688-91. doi: 10.1038/nbt.2654.	transient expression of pcoCas9 gene in plant cells HBT-FLAG
pFGC-pcoCas9	35SPPDK:pcoCas9:NOS cassette (Synthetic)	constitutive 35SPPDK promoter	Basta	Sheen	Sheen lab CRISPR plasmids (unpublished)	A binary plasmid containing 35SPPDK:pcoCas9:NOS cassette for plant expression of Cas9 and multiple cloning sites for insertion of guide RNA pFGC-RCS
pJIT163-2NLSCas9	Cas9 (Other)	2x35S		Gao	Targeted genome modification of crop plants using a CRISPR-Cas system. Nat Biotechnol. 2013 Aug;31(8):686-8. doi: 10.1038/nbt.2650.	Expression of rice codon-optimized Cas9 in plant cells pJIT163
p201N Cas9	Cas9 (Synthetic), nptII (Other)	2x35S, StUbi-3P	G418, kanamycin	Parrott	Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16	Cas9 driven by double 35S, nptII for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP
p201H Cas9	Cas9 (Synthetic), hph (Other)	2x35S, StUbi-3P	Hygromycin	Parrott	Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16	Cas9 driven by double 35S, hygromycin resistance for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP
p201B Cas9	Cas9 (Synthetic), BAR (Other)	2x35S, 2x35S	Basta	Parrott	Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16	Cas9 driven by double 35S, BAR for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP
p201G Cas9	Cas9 (Synthetic), sGFP (Synthetic)	2x35S, 2x35S	GFP	Parrott	Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 2015;15:16	Cas9 driven by double 35S, GFP for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle pPZP
Cas9 MDC123	Glycine Max codon optimized Cas9 (Other)	2X35S	Basta	Stupar	CRISPR/Cas mutagenesis of soybean and Medicago truncatula using a new web-tool and a modified Cas9 enzyme. GM Crops Food. 2015;6(4):243-52. doi: 10.1080/21645698.2015.1106063.	2x35S promoting Glycing Max codon optimized Cas9 with bar plant selection pMDC123
Cas9 MDC32	Glycine Max codon optimized Cas9 (Other)	2X35S	Hygromycin	Stupar	CRISPR/Cas mutagenesis of soybean and Medicago truncatula using a new web-tool and a modified Cas9 enzyme. GM Crops Food. 2015;6(4):243-52. doi: 10.1080/21645698.2015.1106063.	2x35S promoting Glycing Max codon optimized Cas9 with hygromycin plant selection pMDC32
G10 Cas9 MDC123	Glycine Max codon optimized Cas9 (Other)	G10	Basta	Stupar	CRISPR/Cas mutagenesis of soybean and Medicago truncatula using a new web-tool and a modified Cas9 enzyme. GM Crops Food. 2015;6(4):243-52. doi: 10.1080/21645698.2015.1106063.	G10 promoting Glycing Max codon optimized Cas9 (N and C terminus NLS) with bar plant selection pMDC123
pBUE411	gRNA scaffold (Synthetic), zCas9 (Other)	OsU3, Ubi	Basta	Chen	A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327.	CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistance pCambia
pHSE401	gRNA scaffold (Synthetic), zCas9 (Other)	AtU6-26p, 35S	Hygromycin	Chen	A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327.	CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistance pCambia
pKSE401	gRNA scaffold (Synthetic), zCas9 (Other)	AtU6-26p, 35S	Neomycin (select with G418)	Chen	A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327.	CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Kan resistance pCambia
pHUE411	gRNA scaffold (Synthetic), zCas9 (Other)	OsU3, Ubi	Hygromycin	Chen	A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327.	CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Hyg resistance pCambia
pBUN421	gRNA scaffold (Synthetic), zCas9 (Other)	TaU3, Ubi	Basta	Chen	A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14(1):327.	CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (TaU3 promoter), Bar resistance pGreen-like
pRGEB32		Rice snoRNA U3 promoter for gRNA/PTG expression and UBI promoter for Cas9 expression	Hygromycin	Yang	Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci U S A. 2015 Mar 17;112(11):3570-5. doi: 10.1073/pnas.1420294112. Epub 2015 Mar 2.	Express sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated transformation. pRGEB31
pRGE32		Rice snoRNA U3 promoter for gRNA/PTG expression and UBI promoter for Cas9 expression		Yang	Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci U S A. 2015 Mar 17;112(11):3570-5. doi: 10.1073/pnas.1420294112. Epub 2015 Mar 2.	Express sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for transient expression in protoplast pRGE31
pYLCRISPR/Cas9Pubi-H	Cas9 (Other)	maize ubiquitin promoter (Pubi)	Hygromycin	Liu	A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007.	expression of Cas9 in plants, maize ubiquitin promoter (Pubi), hygro selection pCAMBIA1300
pYLCRISPR/Cas9Pubi-B	Cas9 (Other)	maize ubiquitin promoter (Pubi)	Basta	Liu	A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007.	expression of Cas9 in plants, maize ubiquitin promoter (Pubi), basta selection pCAMBIA1300
pYLCRISPR/Cas9P35S-H	Cas9 (Other)	cauliflower mosaic virus 35S promoter (P35S)	Hygromycin	Liu	A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007.	expression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), hygro selection pCAMBIA1300
pYLCRISPR/Cas9P35S-B	Cas9 (Other)	cauliflower mosaic virus 35S promoter (P35S)	Basta	Liu	A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007.	expression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), basta selection pCAMBIA1300
pYLCRISPR/Cas9P35S-N	Cas9 (Other)	cauliflower mosaic virus 35S promoter (P35S)	Neomycin (select with G418)	Liu	A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007.	expression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), Neo selection pCAMBIA1300
pEGB2alpha2 35s:hCas9:tNos (GB0639)	hCas9 (Other)	35S		Orzaez	GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiol. 2013 Jul;162(3):1618-31.	Transcriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter pDGB2alpha2
pICSL11056	Promoter/5UTR: ZmUbi + CDS:SpCas9 + 3UTR/terminator:35s (Other)			Patron	Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7.	Level 1 Golden Gate Cassette: Cas9 expression cassette for monocotyledonous plants pICH47742 (AddGene #47742)
pICSL11060	Promoter/5UTR: CsVMV+ CDS:SpCas9 + 3UTR/terminator:35s (Other)			Patron	Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7.	Level 1 Golden Gate Cassette: Cas9 expression cassette for plants (exemplified in Brassica oleracea) pICH47742 (AddGene #47742)
pYPQ150	pcoCas9 (plant codon-optimized) (Other)			Qi	A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol. 2015 Aug 21. pii: pp.00636.2015.	Gateway entry vector with pcoCas9 (Plant codon optimized) pNJB91
pYPQ154	AteCas9 (Arabidopsis codon optimized) (Other)			Qi	A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol. 2015 Aug 21. pii: pp.00636.2015.	Gateway entry vector with AteCas9 (Arabidopsis codon optimized) pYPQ185-linker2
pYPQ158	hSpCas9 (Human codon optimized) (Other)			Qi	A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol. 2015 Aug 21. pii: pp.00636.2015.	Gateway entry vector with hSpCas9 (Human codon optimized) pNJB185-linker6
pYPQ167	Cas9p (Plant codon-optimized; high GC content at 5 prime region) (Other)			Qi	A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol. 2015 Aug 21. pii: pp.00636.2015.	Gateway entry vector with Cas9p pYPQ185-linker2
pTC217	Nuclease (Cas9/sgRNA) + Donor + GVR (Other)		kanamycin	Voytas	High-frequency, precise modification of the tomato genome. Genome Biol. 2015 Nov 6;16(1):232. doi: 10.1186/s13059-015-0796-9.	Cas9/sgRNA targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based on Bean Yellow Dwarf Virus; sgRNA= 1b pLSLR
pTC223	Nuclease (Cas9/sgRNA) + Donor + GVR (Other)		kanamycin	Voytas	High-frequency, precise modification of the tomato genome. Genome Biol. 2015 Nov 6;16(1):232. doi: 10.1186/s13059-015-0796-9.	Cas9/sgRNA targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based on Bean Yellow Dwarf Virus; sgRNA= 7 pLSLR
pHEE401	sgRNA scaffold (Synthetic), zCas9 (Other)	U6-26p Arabidopsis U6 gene promoter, EC1.2 promoter	Hygromycin	Chen	Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0.	Egg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistance pCambia
pHEE401E	gRNA scaffold (Synthetic), zCas9 (Other)	U6-26p Arabidopsis U6 gene promoter, EC1.2 enhancer fused to EC1.1 promoter	Hygromycin	Chen	Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0.	Egg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistance pCambia
pHEE2E-TRI	sgRNA targeting TRY and CPC genes (Synthetic), sgRNA targeting ETC2 gene (Synthetic), zCas9 (Other)	U6-26p Arabidopsis U6 gene promoter, U6-26p Arabidopsis U6 gene promoter, EC1.2 enhancer fused to EC1.1 promoter	Hygromycin	Chen	Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0.	Egg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPC pCambia
pMpGE010			Hygromycin	Kohchi	pMpGE010 (unpublished)	For CRISPR/Cas9 genome editing in Marchantia polymorpha pMpGWB103
pMpGE011			Chlorsulfuron	Kohchi	pMpGE010 (unpublished)	For CRISPR/Cas9 genome editing in Marchantia polymorpha pMpGWB303
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)	hCas9 (Other)	35S		Orzaez	A modular toolbox for gRNA-Cas9 genome engineering in plants based on the GoldenBraid standard. Plant Methods. 2016 Feb 1;12:10. doi: 10.1186/s13007-016-0101-2. eCollection 2016.	Transcriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181. pDGB2omega2
pBAtC		U6	Basta	Kim	A simple, flexible and high-throughput cloning system for plant genome editing via CRISPR-Cas system. J Integr Plant Biol. 2016 Mar 4. doi: 10.1111/jipb.12474.	Plant expression of Cas9 and gRNA empty backbone; Basta resistance pB2GW7 Tag / Fusion Protein NLS-HA (C terminal on insert)
pHAtC		U6	Hygromycin	Kim	A simple, flexible and high-throughput cloning system for plant genome editing via CRISPR-Cas system. J Integr Plant Biol. 2016 Mar 4. doi: 10.1111/jipb.12474.	Plant expression of Cas9 and gRNA empty backbone; Hygro Resistance pH2GW7
pHDE-35S-Cas9-mCherry			Hygromycin ; mCherry fluorescence	Zhao	An effective strategy for reliably isolating heritable and Cas9-free Arabidopsis mutants generated by CRISPR/Cas9-mediated genome editing. Plant Physiol. 2016 May 15. pii: pp.00663.2016.	For CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plants pHDE
pHDE-35S-Cas9-mCherry-UBQ			Hygromycin ; mCherry fluorescence	Zhao	An effective strategy for reliably isolating heritable and Cas9-free Arabidopsis mutants generated by CRISPR/Cas9-mediated genome editing. Plant Physiol. 2016 May 15. pii: pp.00663.2016.	For CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plants. Enable production of two gRNAs pHDE
pKIR1.1	human-codon-optimized SpCas9 (Other)	AtRPS5A	Hygromycin ; TagRFP in seeds	Higashiyama	pKAMA-ITACHI vectors for highly efficient CRISPR/Cas9-mediated gene knockout in Arabidopsis thaliana. Plant Cell Physiol. 2016 Nov 17. pii: pcw191.	CRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter pFAST-R01
pKI1.1	human-codon-optimized SpCas9 (Other)	AtRPS5A		Higashiyama	pKAMA-ITACHI vectors for highly efficient CRISPR/Cas9-mediated gene knockout in Arabidopsis thaliana. Plant Cell Physiol. 2016 Nov 17. pii: pcw191.	CRISPR/Cas9 for Arabidopsis in pENTR/D-TOPO pENTR/D-TOPO
pKI1.1R	human-codon-optimized SpCas9 (Other)	AtRPS5A	Hygromycin ; TagRFP in seeds	Higashiyama	pKAMA-ITACHI vectors for highly efficient CRISPR/Cas9-mediated gene knockout in Arabidopsis thaliana. Plant Cell Physiol. 2016 Nov 17. pii: pcw191.	CRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter. pFAST-R01
pAGM4723:TpCC_Urease	Cas9 (Other), Urease-targeting gRNA 1 (Other), Urease-targeting gRNA 2 (Other)	FCP, U6, U6	Nourseothricin (Nat)	Mock	Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana Plant Methods 2016, 12:49	Golden Gate Level 2 construct encoding Cas9-YFP and 2 urease-targeting gRNAs pAGM4723
pICH47742:FCP:Cas9YFP	Cas9 (Other)	FCP		Mock	Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana Plant Methods 2016, 12:49	Golden Gate Level 1 cassette encoding a Cas9-YFP fusion under the FCP promoter pICH47742
pYPQ220 (AsCpf1)	AsCpf1 (Other)			Qi	A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nat Plants. 2017 Feb 17;3:17018. doi: 10.1038/nplants.2017.18.	AsCpf1 Gateway entry plasmid pYPQ167
pYPQ230 (LbCpf1)	LbCpf1 (Other)			Qi	A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nat Plants. 2017 Feb 17;3:17018. doi: 10.1038/nplants.2017.18.	LbCpf1 Gateway entry plasmid pYPQ167
pKIR1.0	human-codon-optimized SpCas9 (Other)	AtRPS5A	TagRFP in seeds	Higashiyama	pKAMA-ITACHI vectors for highly efficient CRISPR/Cas9-mediated gene knockout in Arabidopsis thaliana. Plant Cell Physiol. 2016 Nov 17. pii: pcw191.	CRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter. pFAST-R01
pUB-Cas9	Cas9 (Synthetic)	UBIQUITIN10	Hygromycin	Weber	An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana. Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017.	For ubiquitous expression of Cas9 in planta. sgRNA can be introduced as described in Hahn et al. (2017) pKB65
[email protected]	sgRNA against GLABROUS1 (Synthetic)	Arabidopsis U6-26 promoter	Hygromycin	Weber	An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana. Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017.	Disruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9 pUB-Cas9
pTX168			Hygromycin	Voytas	A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.	Express STU (Single Transcriptional Unit) Cas9 with CaMV 35s promoter in plants pCAMBIA1300 Tag / Fusion Protein SV40 NLS (C terminal on insert)
pTX171			Hygromycin	Voytas	A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.	Express STU (Single Transcriptional Unit) Cas9 with CaMV 35s promoter in plants pTX168 Tag / Fusion Protein SV40 NLS (C terminal on insert)
pTX172			Hygromycin	Voytas	A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.	Express STU (Single Transcriptional Unit) Cas9 with Maize Ubiquitin1 promoter in plants pTX171 Tag / Fusion Protein SV40 NLS (C terminal on insert)
pTX176			Hygromycin	Voytas	A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.	Express estrodial-inducible STU (Single Transcriptional Unit) Cas9 in plants pTX171 Tag / Fusion Protein SV40 NLS (C terminal on insert)
pJG80	TaCas9 (Other)			Voytas	High-efficiency gene targeting in hexaploid wheat using DNA replicons and CRISPR/Cas9. Plant J. 2016 Dec 10. doi: 10.1111/tpj.13446.	Entry vector containing TaCas9-nos terminator between attL1 and attR5 sites unknown
pMOD_A0108	AtCas9 (Synthetic)	EC1.2		Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Module A, Promoter: EC1.2, Gene: AtCas9, Terminator: HSP pMOD_A1001
pMOD_A0502	Csy4-P2A-AtCas9 (Synthetic)	AtUbi10		Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Module A, Promoter: AtUbi10, Gene: Csy4-P2A-AtCas9, Terminator: HSP pMOD_A1001
pMOD_A0508	Csy4-P2A-AtCas9 (Synthetic)	EC1.2		Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Module A, Promoter: EC1.2, Gene: Csy4-P2A-AtCas9, Terminator: HSP pMOD_A1001
pMOD_A0901	TREX2-P2A-AtCas9 (Synthetic)	35S		Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Module A, Promoter: 35S, Gene: TREX2-P2A-AtCas9, Terminator: HSP pMOD_A1001
pMOD_A0908	TREX2-P2A-AtCas9 (Synthetic)	EC1.2		Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Module A, Promoter: EC1.2, Gene: TREX2-P2A-AtCas9, Terminator: HSP pMOD_A1001
pMOD_A1110	TaCas9 (Synthetic)	ZmUbi		Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Module A, Promoter: ZmUbi, Gene: TaCas9, Terminator: HSP pMOD_A1001
pMOD_A1111	TaCas9 (Synthetic)	OsAct1		Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Module A, Promoter: OsAct1, Gene: TaCas9, Terminator: HSP pMOD_A1001
pMOD_A1510	Csy4-P2A-TaCas9 (Synthetic)	ZmUbi		Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Module A, Promoter: ZmUbi, Gene: Csy4-P2A-TaCas9, Terminator: HSP pMOD_A1001
pMOD_A1511	Csy4-P2A-TaCas9 (Synthetic)	OsAct1		Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Module A, Promoter: OsAct1, Gene: Csy4-P2A-TaCas9, Terminator: HSP pMOD_A1001
pDIRECT_21A	Engineering Reagent: 35S:AtCas9 + AtU6:gRNA (Synthetic)		Hygromycin	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:hpt II pTRANS_210
pDIRECT_21C	Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers (Synthetic)		Hygromycin	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers , Plant Selection: 2x35S:hpt II pTRANS_210d
pDIRECT_22A	Engineering Reagent: 35S:AtCas9 + AtU6:gRNA (Synthetic)		Kanamycin	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:npt II pTRANS_220
pDIRECT_22C	Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers (Synthetic)		Kanamycin	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers , Plant Selection: 2x35S:npt II pTRANS_220d
pDIRECT_23A	Engineering Reagent: 35S:AtCas9 + AtU6:gRNA (Synthetic)		Basta	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:bar pTRANS_230
pDIRECT_23C	Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers (Synthetic)		Basta	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Direct Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers , Plant Selection: 2x35S:bar pTRANS_230d
pDIRECT_25F	Engineering Reagent: ZmUbi:TaCas9 + TaU6:gRNA (Synthetic)		Hygromycin	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Direct Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9 + TaU6:gRNA, Plant Selection: PvUbi2:hpt II pTRANS_250d
pDIRECT_25H	Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers (Synthetic)		Hygromycin	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Direct Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt II pTRANS_250d
pDIRECT_26H	Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers (Synthetic)		Basta	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Direct Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:bar pTRANS_260d
pAtCas9_1	AtCas9 (Synthetic)		Hygromycin	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Cas9 only expression, Cas9 Type: AtCas9, Plant Selection: 2x35S:hpt II pCAMBIA
pAtCas9_3	AtCas9 (Synthetic)		Basta	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Cas9 only expression, Cas9 Type: AtCas9, Plant Selection: 2x35S:bar pCAMBIA
pTaCas9_5	TaCas9 (Synthetic)		Hygromycin	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Cas9 only expression, Cas9 Type: TaCas9, Plant Selection: PvUbi2:hpt II pCAMBIA
pTaCas9_6	TaCas9 (Synthetic)		Basta	Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Cas9 only expression, Cas9 Type: TaCas9, Plant Selection: PvUbi2:bar pCAMBIA
pDIRECT_10A	35S:AtCas9 + AtU6:gRNA (Synthetic)			Voytas	A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.	Direct Cloning, Type: non-T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: none pTRANS_100
pKEE401			Neomycin (select with G418)	Chen	Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0.	CRISPR/Cas9-mediated genome editing in Arabidopsis. Contains Cas9 and empty gRNA scaffold, Kan resistance pCambia
pXEE401B				Chen	Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0.	CRISPR/Cas9-mediated genome editing in Arabidopsis. Contains Cas9 and empty gRNA scaffold, Bar resistance pCambia
pXEE401BG				Chen	Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0.	CRISPR/Cas9-mediated genome editing in Arabidopsis, Bar and glyphosate-resistance pCambia
pSC10				Stupar	CRISPR/Cas9 and TALENs generate heritable mutations for genes involved in small RNA processing of Glycine max and Medicago truncatula. Plant Biotechnol J. 2017 Oct 31. doi: 10.1111/pbi.12857.	pAH595-gRNA 2xplex entry cassette pENTR top
pSC12				Stupar	CRISPR/Cas9 and TALENs generate heritable mutations for genes involved in small RNA processing of Glycine max and Medicago truncatula. Plant Biotechnol J. 2017 Oct 31. doi: 10.1111/pbi.12857.	pNB184-Cas9 entry cassette pENTR top
pYLCRISPR/Cas9pUbi-N	Cas9 (Synthetic)	ZmUbi		Liu	A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007.	Expression of Cas9 in plants, ZmUbi promoter, Kanamycin selection pCAMBIA1300
pJKW0458		p35S		Weng	pJKW0457 (unpublished)	p35S:CAS9 pEarleyGate100
pJKW0474		Arabidopsis CLAVATA3		Weng	pJKW0457 (unpublished)	pCLV3:Cas9 pEarleyGate100
pMpGE006	Atco-Cas9-Pea3ter (Synthetic)	MpEFpro	Hygromycin	Sugano	pMpGE010 (unpublished)	Cas9 expression in M.polymorpha pMpGWB103
pYPQ239	FnCpf1 (Other)			Qi	Plant Genome Editing Using FnCpf1 and LbCpf1 Nucleases at Redefined and Altered PAM Sites. Mol Plant. 2018 Jul 2;11(7):999-1002. doi: 10.1016/j.molp.2018.03.008. Epub 2018 Mar 20.	FnCpf1 Gateway entry plasmid pYPQ167 Tags / Fusion Proteins NLS (N terminal on insert) NLS (C terminal on insert)
pYPQ230-RR	LbCpf1-RR (LbCpf1 with G548R and K611R mutations) (Other)			Qi	Plant Genome Editing Using FnCpf1 and LbCpf1 Nucleases at Redefined and Altered PAM Sites. Mol Plant. 2018 Jul 2;11(7):999-1002. doi: 10.1016/j.molp.2018.03.008. Epub 2018 Mar 20.	LbCpf1 Gateway entry plasmid with G548R and K611R mutations pYPQ167 Tags / Fusion Proteins NLS (N terminal on insert) NLS (C terminal on insert)
pYPQ230-RVR	LbCpf1-RVR (LbCpf1 with G548R, K554V and Y558R mutations) (Other)			Qi	Plant Genome Editing Using FnCpf1 and LbCpf1 Nucleases at Redefined and Altered PAM Sites. Mol Plant. 2018 Jul 2;11(7):999-1002. doi: 10.1016/j.molp.2018.03.008. Epub 2018 Mar 20.	LbCpf1 Gateway entry plasmid with G548R, K554V and Y558R mutations pYPQ167 Tags / Fusion Proteins NLS (N terminal on insert) NLS (C terminal on insert)
pYPQ239-RR	FnCpf1-RR (FnCpf1 with N623R and K687R mutations) (Other)			Qi	Plant Genome Editing Using FnCpf1 and LbCpf1 Nucleases at Redefined and Altered PAM Sites. Mol Plant. 2018 Jul 2;11(7):999-1002. doi: 10.1016/j.molp.2018.03.008. Epub 2018 Mar 20.	FnCpf1 Gateway entry plasmid with N623R and K687R mutations pYPQ167 Tags / Fusion Proteins NLS (N terminal on insert) NLS (C terminal on insert)
pYPQ239-RVR	FnCpf1-RVR (FnCpf1 with N623R, K629R and N633R mutations) (Other)			Qi	Plant Genome Editing Using FnCpf1 and LbCpf1 Nucleases at Redefined and Altered PAM Sites. Mol Plant. 2018 Jul 2;11(7):999-1002. doi: 10.1016/j.molp.2018.03.008. Epub 2018 Mar 20.	FnCpf1 Gateway entry plasmid with N623R, K629R and N633R mutations pYPQ167 Tags / Fusion Proteins NLS (N terminal on insert) NLS (C terminal on insert)
pYPQ165	zCas9 (Other)	Promoter EC1.2 enhancer fused to EC1.1 promoter		Qi	Activities and specificities of CRISPR/Cas9 and Cas12a nucleases for targeted mutagenesis in maize. Plant Biotechnol J. 2018 Jul 4. doi: 10.1111/pbi.12982.	Gateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zCas9-NLS driven by egg cell-specific promoter pYPQ167 Tags / Fusion Proteins 3x FLAG, NLS (N terminal on insert) NLS (C terminal on insert)
pORFE0001	AtCAS9 (Other)			Chevalier	Chevalier Lab plasmids (unpublished)	AtCas9 module CDS1 pICH41308
pORFE1001	AtCAS9 (Other)	2x35S		Chevalier	Chevalier Lab plasmids (unpublished)	Overexpression of the AtCAS9 in plant under 2x35S promoter pICH47742

C. elegans

Plasmid	Gene/Insert	Promoter	PI	Publication	Hidden Extra Search Info
Peft-3::cas9-SV40_NLS::tbb-2 3'UTR	codon optimized Cas9_SV40 NLS with intron (Synthetic)	eef-1A.1 (eft-3)	Calarco	Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532.	pUC57
pDD162 (Peft-3::Cas9 + Empty sgRNA)	Cas9 (Synthetic), Empty sgRNA (Other)	eef-1A.1 (eft-3) , U6	Goldstein	Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641.	Cas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome. pCFJ601
SP6-hCas9-Ce-mRNA	hCas9 with C. elegans 5' and 3' UTRs (Homo sapiens)	SP6	Sternberg	Transgene-Free Genome Editing in Caenorhabditis elegans Using CRISPR-Cas. Genetics. 2013 Aug 26.	In vitro transcription of a mRNA encoding humanized Cas9 nuclease, with 3' UTRs suitable for germline expression in C. elegans, for doing CRISPR-Cas by RNA injection. Uses SP6 RNA polymerase. Bluescript
pIK86	Cas9 (Synthetic)	T7	Katic	Targeted Heritable Mutation and Gene Conversion by Cas9-CRISPR in Caenorhabditis elegans. Genetics. 2013 Aug 26.	C. elegans codon-optimized Cas9 with 2xSV40 NLS sequences. It has a T7 promoter for in vitro transcription, germline-compatible 5'UTR, tbb-2 3'UTR and a polyA sequence. pUC57
pMB62	Cas9 (Synthetic)	eef-1A.1 (eft-3)	Boxem	CRISPR/Cas9-Targeted Mutagenesis in Caenorhabditis elegans. Genetics. 2013 Aug 26.	Expresses C. elegans optimized Cas9::mEGFP from the eef-1A.1 (eft-3) promoter pBluescript SK+
pMB63	Cas9 (Synthetic)	eef-1A.1 (eft-3)	Boxem	CRISPR/Cas9-Targeted Mutagenesis in Caenorhabditis elegans. Genetics. 2013 Aug 26.	Expresses C. elegans optimized Cas9 from the eef-1A.1 (eft-3) promoter pBluescript SK+
pMB66	Cas9 (Synthetic)	hsp-16.48	Boxem	CRISPR/Cas9-Targeted Mutagenesis in Caenorhabditis elegans. Genetics. 2013 Aug 26.	Expresses C. elegans optimized Cas9::mEGFP from the hsp-16.48 promoter pBluescript SK+
pMB67	Cas9 (Synthetic)	hsp-16.48	Boxem	CRISPR/Cas9-Targeted Mutagenesis in Caenorhabditis elegans. Genetics. 2013 Aug 26.	Expresses C. elegans optimized Cas9 from the hsp-16.48 promoter pBluescript SK+
peft-3::cas-9::tbb-2 3'UTR	cas9	eef-1A.1 (eft-3)	de Bono	Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination. Nucleic Acids Res. 2013 Sep 5.	this plasmid contains the codon optimized gene encoding Cas9 for C. elegans. pDEST
pJW1259	Deletion		Ward	Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Genetics. 2014 Dec 9. pii: genetics.114.172361.	Cas9 plasmid with sgRNA deleted; for use in C. elegans pJW1219
pME-Cas9	codon optimized Cas9 (Other)		Chen	Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 2015 Apr 8. pii: genetics.115.176917.	expresses codon optimized Cas9 in zebrafish pME-MCS
AP56-5	sgRNA for APa13 (Caenorhabditis elegans)	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162
AP56-6	sgRNA for APa13 (Caenorhabditis elegans)	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162
AP56-7	sgRNA for APa13 (Caenorhabditis elegans)	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162
AP56-8	sgRNA for APa13 (Caenorhabditis elegans)	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162
AP54-3	sgRNA for APs12 (Caenorhabditis elegans)	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162
AP54-5	sgRNA for APs12 (Caenorhabditis elegans)	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162
APq5271	sgRNA for APa4-2	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORF pDD162
APq5210	sgRNA for APa4-2	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORF pDD162
AP303-3	sgRNA for APs1	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2 pDD162
AP303-4	sgRNA for APs1	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2 pDD162
AP332-2	sgRNA for APs4	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2 pDD162
AP332-3	sgRNA for APs4	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2 pDD162
AP332-4	sgRNA for APs4	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2 pDD162
AP324-2	sgRNA for APs6	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162
AP324-3	sgRNA for APs6	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162
AP324-4	sgRNA for APs6	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162
AP334-2	sgRNA for APs5	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162
AP334-5	sgRNA for APs5	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162
AP334-6	sgRNA for APs5	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162
APCSD 53	sgRNA for CSD 53	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans swan-2 pDD162
APCSD 54	sgRNA for CSD 54	U6	Seydoux	Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.	co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans swan-2 pDD162
AP568-2	sgRNA for dpy‐10		Seydoux	High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 2015 Sep;201(1):47-54. doi: 10.1534/genetics.115.179382. Epub 2015 Jul 17.	co-expression of Cas9 and crRNA 589 target sequence pDD162
AP568-3	sgRNA for dpy‐10		Seydoux	High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 2015 Sep;201(1):47-54. doi: 10.1534/genetics.115.179382. Epub 2015 Jul 17.	co-expression of Cas9 and crRNA 589 target sequence pDD162
pRB1080	VQR Cas9 variant (Synthetic)	eef-1A.1 (eft-3)	Fire	Cas9 Variants Expand the Target Repertoire in Caenorhabditis elegans. Genetics. 2015 Dec 17. pii: genetics.115.185041.	Expresses VQR Cas9 variant with eef-1A.1 (eft-3) promoter pCFJ601
pRB1081	dpy-10 gRNA (Synthetic)	U6	Fire	Cas9 Variants Expand the Target Repertoire in Caenorhabditis elegans. Genetics. 2015 Dec 17. pii: genetics.115.185041.	Expresses gRNA for dpy-10 conversion using NGAG PAM and VQR Cas9 variant pRB1017
pRB1083	VRER Cas9 variant (Synthetic)	eft-3 (eef-1A.1)	Fire	Cas9 Variants Expand the Target Repertoire in Caenorhabditis elegans. Genetics. 2015 Dec 17. pii: genetics.115.185041.	Expresses VRER Cas9 variant with eef-1A.1 (eft-3) promoter pCFJ601
pRB1084	dpy-10 gRNA (Synthetic)	U6	Fire	Cas9 Variants Expand the Target Repertoire in Caenorhabditis elegans. Genetics. 2015 Dec 17. pii: genetics.115.185041.	Expresses gRNA for dpy-10 conversion using NGCG PAM and VRER Cas9 mutant pRB1017
pUAS:Cas9T2AGFP;U6:sgRNA1;U6:sgRNA2	5x UAS (Saccharomyces cerevisiae), Cas9 (Other), T2A, GFP, U6 promoter (Danio rerio)		Del Bene	2C-Cas9: a versatile tool for clonal analysis of gene function. Genome Res. 2016 Mar 8.	Tissue-specific knock-out in zebrafish, Cas9 and GFP driven by a UAS promoter pminiTol2
pUAS:Cas9T2ACre;U6:sgRNA1;U6:sgRNA2	5xUAS, Cas9, Cre, U6 promoter		Del Bene	2C-Cas9: a versatile tool for clonal analysis of gene function. Genome Res. 2016 Mar 8.	Tissue-specific knock-out in zebrafish, Cas9 and Cre driven by a UAS promoter pminiTol2
pDD121	Cas9 (Synthetic)		Goldstein	Unpublished SapTrap/SEC plasmids (unpublished)	Cas9 expression in C. elegans pCFJ601
pCFJ150-Cas9(dpiRNA)	Cas9(dpiRNA) (Caenorhabditis elegans)	eft-3	Lee	The piRNA targeting rules and the resistance to piRNA silencing in endogenous genes. Science. 2018 Feb 2;359(6375):587-592. doi: 10.1126/science.aao2840. Epub 2018 Feb 1.	eft-3p::Cas9(dpiRNA)::tbb-2 3'UTR construct used for MosSCI in nematode. Cas9 is optimized by removing all piRNA targeting sites to allow germline expression. pCFJ150
Ccas9LacZ			Vellai	Highly efficient RNAi and Cas9-based auto-cloning systems for C. elegans research. Nucleic Acids Res. 2018 Jun 19. pii: 5040046. doi: 10.1093/nar/gky516.	Enhanced C. elegans Cas9 vector. Ccas9LacZ contains a lacZ coding sequence, two Cas9 and two type-IIs restriction enzyme recognition sites next to the U6 promoter and gRNA sequences. pDD162 (Peft-3::Cas9 + Empty sgRNA, Addgene no.: #47549)

Yeast

Plasmid	Gene/Insert	Promoter	Selectable Marker	PI	Publication	Hidden Extra Search Info
p414-TEF1p-Cas9-CYC1t	Human Optimized S. pyogenes Cas9 (Homo sapiens)	TEF1 promoter	TRP1	Church	Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res	p414
p415-GalL-Cas9-CYC1t	Human Optimized S. pyogenes Cas9 (Homo sapiens)	GalL	LEU2	Church	Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res	p415
pACT2-CAS9c	Cas9c (Synthetic)	yeast ADH1 promoter	LEU2	Zhao	Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.	Express Eukaryotic-codon-optimized Cas9c gene in yeast under ADH1 promoter for genome editing. SV40 NLS is fused to the C terminal. GAL4 region from pACT2 is removed. pACT2
pMZ222	Cas9 (Other)	adh1	LEU2	Zaratiegui	Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.	Constitutive expression of humanized Cas9 pART1
pMZ374	Cas9 (Other), rrk1:sgRNA (Other)	adh1, rrk1	ura4	Zaratiegui	Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.	Combination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: Empty sgRNA target (CspCI placeholder) (see comments). pMZ283
pCT	iCas9 (Other), tracrRNA (Other)	TEF1p, RPR1p	LEU2	Zhao	Homology-Integrated CRISPR-Cas (HI-CRISPR) System for One-Step Multigene Disruption in Saccharomyces cerevisiae. ACS Synth Biol. 2014 Sep 19.	Plasmid encoding iCas9 and tracrRNA on pRS415 backbone pRS415
pCRCT	iCas9 (Other), tracrRNA (Other)	TEF1p, RPR1p	URA3	Zhao	Homology-Integrated CRISPR-Cas (HI-CRISPR) System for One-Step Multigene Disruption in Saccharomyces cerevisiae. ACS Synth Biol. 2014 Sep 19.	Plasmid encoding iCas9, tracrRNA and crRNAs pRS426
Cas9-NAT	Human-optimized S. pyogenes Cas9 with Clonnat marker gene expression cassette		Nourseothricin(clonNat)	Jin	Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3.	Cas9 expression cassette carried by a yeast single-copy episome plasmid pRS414-TEF1p-Cas9-CYC1t
pML104	Cas9 (Saccharomyces cerevisiae), single guide RNA expression cassette (Saccharomyces cerevisiae)	pTDH3, pSNR52	URA3	Wyrick	New vectors for simple and streamlined CRISPR-Cas9 genome editing in Saccharomyces cerevisiae. Yeast. 2015 Dec;32(12):711-20. doi: 10.1002/yea.3098. Epub 2015 Sep 21.	Expresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains URA3 marker for yeast transformation pRSII426
pML107	Cas9 (Saccharomyces cerevisiae), single guide RNA expression cassette (Saccharomyces cerevisiae)	pTDH3 (aka GAP promoter), pSNR52	LEU2	Wyrick	New vectors for simple and streamlined CRISPR-Cas9 genome editing in Saccharomyces cerevisiae. Yeast. 2015 Dec;32(12):711-20. doi: 10.1002/yea.3098. Epub 2015 Sep 21.	Expresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains LEU2 marker for yeast transformation pRSII425
pJH001	Cas9 (Saccharomyces cerevisiae), Empty		LEU2	Wyrick	New vectors for simple and streamlined CRISPR-Cas9 genome editing in Saccharomyces cerevisiae. Yeast. 2015 Dec;32(12):711-20. doi: 10.1002/yea.3098. Epub 2015 Sep 21.	High copy Cas9 expression vector with LEU2 marker for yeast transformation pRSII425
p415-PtrpC-Cas9-TtrpC-CYC1t	humanized Cas9 (Homo sapiens)		LEU2	Hong	Efficient gene editing in Neurospora crassa with CRISPR technology Fungal Biology and Biotechnology 2015, 2:4	Express humanized Cas9 under the control of trpC promoter and terminator from A. nidulans. pRS415
pCRISPRyl	Codon optimized Cas9 from S. pyogenes (Synthetic), sgRNA expression cassette (Synthetic)	UAS1B8-TEF(136), SCR1'-tRNA	LEU2	Wheeldon	Synthetic RNA polymerase III promoters facilitate high efficiency CRISPR-Cas9 mediated genome editing in Yarrowia lipolytica. ACS Synth Biol. 2015 Dec 29.	CRISPR/Cas9 vector for Yarrowia lipolytica, with AvrII site for sgRNA insertion pUC19
pMZ376	Cas9 (Other), rrk1:sgRNA (Other)	adh1, rrk1	Neomycin (select with G418)	Zaratiegui	sgRNA/Cas9 (unpublished)	Combined sgRNA/Cas9 vector with KanMX marker pMZ374
pMZ377	Cas9 (Other), rrk1:sgRNA (Other)	adh1, rrk1	LEU2	Zaratiegui	sgRNA/Cas9 (unpublished)	Combined sgRNA/Cas9 vector with LEU2 marker pMZ374
pMZ379	Cas9 (Other), rrk1:sgRNA (Other)	adh1, rrk1	nourseothricin	Zaratiegui	sgRNA/Cas9 (unpublished)	Combined sgRNA/Cas9 vector with NatMX marker pMZ374
pCfB2312 (TEF1p-Cas9-CYC1t_kanMX)	Cas9 (Other)		Gentamicin	Borodina	EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.	Expresses Cas9 protein, under the control of the TEF1 promoter, and CYC terminator. KanMX resistance pRS414
pRS416gT-GalL-Cas9	Cas9 (Synthetic), guide RNA (gRNA) (Synthetic), Tetracycline Repressor (Other)	GalL, RPR1 promoter with TetO site, GPM1 promoter	URA3	Davis	Distinct patterns of Cas9 mismatch tolerance in vitro and in vivo. Nucleic Acids Res. 2016 May 19. pii: gkw417.	pRS416 (URA) + RPR1(TetO) promoter with gRNA locus + Tetracycline Repressor + GalL promoter driven Cas9 for yeast expression pRS416
pRCC-K	Cas9 (Other), empty gRNA cassette (Synthetic)	ROX3, SNP52p	Neomycin (select with G418)	Boles	Simplified CRISPR-Cas genome editing for Saccharomyces cerevisiae. J Microbiol Methods. 2016 Aug;127:203-5. doi: 10.1016/j.mimet.2016.06.020. Epub 2016 Jun 17.	Expression of Cas9 and gRNA cassette in S. cerevisiae; Kan Resistance pRS42K Tag / Fusion Protein NTS (C terminal on backbone)
pRCC-N	Cas9 (Other), empty gRNA cassette (Synthetic)	ROX3, SNP52p	Nourseothricin	Boles	Simplified CRISPR-Cas genome editing for Saccharomyces cerevisiae. J Microbiol Methods. 2016 Aug;127:203-5. doi: 10.1016/j.mimet.2016.06.020. Epub 2016 Jun 17.	Expression of Cas9 and gRNA cassette in S. cerevisiae; Nourseothricin Resistance pRS42N Tag / Fusion Protein NTS (C terminal on backbone)
pDuRCC-K	Cas9 (Other), empty gRNA cassette (Synthetic), empty gRNA cassette (Synthetic)	ROX3, SNP52p, SNP52p	Neomycin (select with G418)	Boles	Simplified CRISPR-Cas genome editing for Saccharomyces cerevisiae. J Microbiol Methods. 2016 Aug;127:203-5. doi: 10.1016/j.mimet.2016.06.020. Epub 2016 Jun 17.	Expression of Cas9 and two gRNA cassettes in S. cerevisiae; Kan Resistance pRS42K Tag / Fusion Protein NTS (C terminal on backbone)
pDuRCC-N	Cas9 (Other), empty gRNA cassette (Synthetic), empty gRNA cassette (Synthetic)	ROX3, SNP52p, SNP52p	Nourseothricin	Boles	Simplified CRISPR-Cas genome editing for Saccharomyces cerevisiae. J Microbiol Methods. 2016 Aug;127:203-5. doi: 10.1016/j.mimet.2016.06.020. Epub 2016 Jun 17.	Expression of Cas9 and two gRNA cassettes in S. cerevisiae; Nourseothricin Resistance pRS42N Tag / Fusion Protein NTS (C terminal on backbone)
pML104-HygMx4	HphMX4 (Other)		Hygromycin	Wittkopp	Patricia Wittkopp yeast CRISPR plasmids (unpublished)	Expresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains HphMx4 marker for yeast transformation. pRSII426
pML104-KanMx4	KanMX4 (Other)		Neomycin (select with G418)	Wittkopp	Patricia Wittkopp yeast CRISPR plasmids (unpublished)	Expresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains KanMx4 marker for yeast transformation. pRSII426
pML104-NatMx3	NatMx3 (Other)		nourseothricin (nat)	Wittkopp	Patricia Wittkopp yeast CRISPR plasmids (unpublished)	Expresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains NatMX3 marker for yeast transformation. pRSII426
pCfB2312 (TEF1p-Cas9-CYC1t_kanMX)	Cas9 (Other)		G418	Borodina	CRISPR–Cas system enables fast and simple genome editing of industrial Saccharomyces cerevisiae strains Metab Eng Commun 2015	Cas9-carrying vector with kanMX marker p414-TEF1p-Cas9-CYC1t
pCRISPRyl_AXP	Cas9	UAS1B8-TEF(136)	LEU2	Wheeldon	Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19.	Introduces DSB at AXP locus in Y. lipolytica pUC19
pCRISPRyl_XPR2	Cas9	UAS1B8-TEF(136)	LEU2	Wheeldon	Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19.	Introduces DSB at XPR2 locus in Y. lipolytica pUC19
pCRISPRyl_A08	Cas9	UAS1B8-TEF(136)	LEU2	Wheeldon	Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19.	Introduces DSB at A08 locus in Y. lipolytica pUC19
pCRISPRyl_D17	Cas9	UAS1B8-TEF(136)	LEU2	Wheeldon	Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19.	Introduces DSB at D17 locus in Y. lipolytica pUC19
pCRISPRyl_MFE1	Cas9	UAS1B8-TEF(136)	LEU2	Wheeldon	Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19.	Introduces DSB at MFE1 locus in Y. lipolytica pUC19
pJB172	gRNA targeting pil1 (Schizosaccharomyces pombe)		Fluoride	Berro	Use of a fluoride channel as a new selection marker for fission yeast plasmids and application to fast genome editing with CRISPR/Cas9. Yeast. 2016 Oct;33(10):549-557. doi: 10.1002/yea.3178. Epub 2016 Sep 7.	CRISPR/Cas9 in fission yeast using fluoride selection and targetting pil1 pJB166
pJK-caCas9-NatMX-Neut5L			Nourseothricin	Church	A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nat Microbiol. 2018 Jan;3(1):73-82. doi: 10.1038/s41564-017-0043-0. Epub 2017 Oct 23.	caCas9 integrating vector into the Neut5L locus pJK1027
pJK-caCas9-NatMX-Neut5L-Ade2 drive	Ade2 gene drive (Other)		Nourseothricin	Church	A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nat Microbiol. 2018 Jan;3(1):73-82. doi: 10.1038/s41564-017-0043-0. Epub 2017 Oct 23.	caCas9 integrating vector into the Neut5L locus with gene drive for targeting Ade2 locus pJK1027
pJK-caCas9-NatMX-Neut5L-Leu2 drive	Leu2 gene drive (Other)			Church	A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nat Microbiol. 2018 Jan;3(1):73-82. doi: 10.1038/s41564-017-0043-0. Epub 2017 Oct 23.	caCas9 integrating vector into the Neut5L locus with gene drive for targeting Leu2 locus pjk1027
pWS158	Cas9 (Saccharomyces cerevisiae)		URA3	Ellis	Ellis Lab Yeast CRISPR Plasmids (unpublished)	Cas9 gap repair vector - URA3 2 micron
pWS171	Cas9 (Saccharomyces cerevisiae)		LEU2	Ellis	Ellis Lab Yeast CRISPR Plasmids (unpublished)	Cas9 gap repair vector - LEU2 2 micron
pWS172	Cas9 (Saccharomyces cerevisiae)		HIS3	Ellis	Ellis Lab Yeast CRISPR Plasmids (unpublished)	Cas9 gap repair vector - HIS3 2 micron
pWS173	Cas9 (Saccharomyces cerevisiae)		Kanamycin (select with G418)	Ellis	Ellis Lab Yeast CRISPR Plasmids (unpublished)	Cas9 gap repair vector - KanR 2 micron
pWS174	Cas9 (Saccharomyces cerevisiae)		Nourseothricin	Ellis	Ellis Lab Yeast CRISPR Plasmids (unpublished)	Cas9 gap repair vector - NatR 2 micron
pWS175	Cas9 (Saccharomyces cerevisiae)		Hygromycin	Ellis	Ellis Lab Yeast CRISPR Plasmids (unpublished)	Cas9 gap repair vector - HygR 2 micron
pADH99	US_HIS1, FRT, pENO1, C. albicans Cas9, pMAL2, FLP, NAT 1 of 2		Nourseothricin (NAT)	Hernday	An efficient, rapid, and recyclable system for CRISPR-mediated genome editing in Candida albicans mSphere Apr 2017, 2 (2) e00149-17	NAT-marked CAS9 expression construct; part 1 of 2 of C.alb HIS1-FLP CRISPR system. Use with pADH100-series gRNA expression constructs. pUC19
pADH137	C. albicans LEU2 1 of 2, pENO1, Cas9, NAT 1 of 2		Nourseothricin (NAT)	Hernday	An efficient, rapid, and recyclable system for CRISPR-mediated genome editing in Candida albicans mSphere Apr 2017, 2 (2) e00149-17	NAT-marked CAS9 expression construct; part 1 of 2 of C.alb LEUpOUT CRISPR system. Use with pADH118-series gRNA expression constructs. pUC19
pADH140	C. maltosa LEU2 1 of 2, pENO1, Cas9, NAT 1 of 2		Nourseothricin (NAT)	Hernday	An efficient, rapid, and recyclable system for CRISPR-mediated genome editing in Candida albicans mSphere Apr 2017, 2 (2) e00149-17	NAT-marked CAS9 expression construct; part 1 of 2 of C.mal LEUpOUT CRISPR system. Use with pADH143-series gRNA expression constructs. pUC19
pDHt/sk-PC	Cas9 (Other)	Ppdc	Hygromycin	Zhou	Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discov. 2015 May 12;1:15007. doi: 10.1038/celldisc.2015.7. eCollection 2015.	Expression of codon-optimized Cas9 with Ppdc promoter in Trichoderma reesei pDHt/sk
pDHt/sk-PE	Cas9-eGFP (Other)	Ppdc	Hygromycin	Zhou	Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discov. 2015 May 12;1:15007. doi: 10.1038/celldisc.2015.7. eCollection 2015.	Expression of codon-optimized Cas9-eGFP fusion protein with Ppdc promoter in Trichoderma reesei pDHt/sk Tag / Fusion Protein EGFP (C terminal on insert)
pDHt/sk-CC	Cas9 (Other)	Pcbh1	Hygromycin	Zhou	Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discov. 2015 May 12;1:15007. doi: 10.1038/celldisc.2015.7. eCollection 2015.	Expression of codon-optimized Cas9 with Pcbh1 promoter in Trichoderma reesei pDHt/sk
pDHt/sk-CE	Cas9-eGFP (Other)	Pcbh2	Hygromycin	Zhou	Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discov. 2015 May 12;1:15007. doi: 10.1038/celldisc.2015.7. eCollection 2015.	Expression of codon-optimized Cas9-eGFP fusion protein with Pcbh1 promoter in Trichoderma reesei pDHt/sk Tag / Fusion Protein EGFP (C terminal on insert)
pYZ033			Spura4	Boeke	Construction of Designer Selectable Marker Deletions with CRISPR-Cas9 Toolbox in Schizosaccharomyces pombe and Optimized Design of Common Entry Vectors. G3 (Bethesda). 2018 Jan 10. pii: g3.117.300363. doi: 10.1534/g3.117.300363.	Entry vector for S. pombe CRISPR-Cas9 system. The gRNA can be integrated easily through Gibson Assembly with the plasmid backbone digested by Not1 pMZ374
pYZ146	gRNA targeting Sp.leu1 (Schizosaccharomyces pombe)		Spura4	Boeke	Construction of Designer Selectable Marker Deletions with CRISPR-Cas9 Toolbox in Schizosaccharomyces pombe and Optimized Design of Common Entry Vectors. G3 (Bethesda). 2018 Jan 10. pii: g3.117.300363. doi: 10.1534/g3.117.300363.	Cas9-gRNA leu1 plasmid for leu1 deletion in S. pombe pYZ033 leu1 SPBC1A4.02c
pYZ164	gRNA targeting Sp.his3 (Schizosaccharomyces pombe)		Spura4	Boeke	Construction of Designer Selectable Marker Deletions with CRISPR-Cas9 Toolbox in Schizosaccharomyces pombe and Optimized Design of Common Entry Vectors. G3 (Bethesda). 2018 Jan 10. pii: g3.117.300363. doi: 10.1534/g3.117.300363.	Cas9-gRNA his3 plasmid for his3 deletion in S. pombe pYZ033 his3 SPBC11B10.02c
pYZ173	gRNA targeting Sp.lys9 (Schizosaccharomyces pombe)		Spura4	Boeke	Construction of Designer Selectable Marker Deletions with CRISPR-Cas9 Toolbox in Schizosaccharomyces pombe and Optimized Design of Common Entry Vectors. G3 (Bethesda). 2018 Jan 10. pii: g3.117.300363. doi: 10.1534/g3.117.300363.	Cas9-gRNA lys9 plasmid for lys9 deletion in S. pombe pYZ033 SPBC3B8.03 SPBC3B8.03
pDB4279	Cas9 (Other)			Du	A Cloning-Free Method for CRISPR/Cas9-Mediated Genome Editing in Fission Yeast. G3 (Bethesda). 2018 Apr 27. pii: g3.118.200164. doi: 10.1534/g3.118.200164.	A control plasmid containing the intact bsdMX marker pMZ374 (Addgene 59896)
pDB4280	Cas9 (Other)			Du	A Cloning-Free Method for CRISPR/Cas9-Mediated Genome Editing in Fission Yeast. G3 (Bethesda). 2018 Apr 27. pii: g3.118.200164. doi: 10.1534/g3.118.200164.	A Cas9-encoding plasmid containing the 5' portion of the ura4 marker and the rrk1 promoter/leader. When linearized by NotI, it serves as the gapped vector in the split-ura4 system pMZ374 (Addgene 59896)
pDB4281	Cas9 (Other)			Du	A Cloning-Free Method for CRISPR/Cas9-Mediated Genome Editing in Fission Yeast. G3 (Bethesda). 2018 Apr 27. pii: g3.118.200164. doi: 10.1534/g3.118.200164.	A Cas9-encoding plasmid containing the 5' portion of the bsdMX marker and the rrk1 promoter/leader. When linearized by NotI, it serves as the gapped vector in the split-bsdMX system pMZ374 (Addgene 59896)
pIW447-CRISPR XYL2	Codon optimized Cas9 (Synthetic), sgRNA expression cassette (Synthetic)		URA3	Wheeldon	CRISPR-Cas9-enabled genetic disruptions for understanding ethanol and ethyl acetate biosynthesis in Kluyveromyces marxianus. Biotechnol Biofuels. 2017 Jun 24;10:164. doi: 10.1186/s13068-017-0854-5. eCollection 2017.	K. marxianus CRISPR Plasmid for XYL2 editing pJSK316-GPD
pIW601-KmCRISPR	Codon optimized Cas9 (Synthetic), sgRNA expression cassette (Synthetic)		URA3	Wheeldon	CRISPR-Cas9-enabled genetic disruptions for understanding ethanol and ethyl acetate biosynthesis in Kluyveromyces marxianus. Biotechnol Biofuels. 2017 Jun 24;10:164. doi: 10.1186/s13068-017-0854-5. eCollection 2017.	K. marxianus CRISPR Plasmid for sgRNA cloning pJSK316-GPD
bRA89			Hygromycin	Haber	Rad51-mediated double-strand break repair and mismatch correction of divergent substrates. Nature. 2017 Apr 20;544(7650):377-380. doi: 10.1038/nature22046. Epub 2017 Apr 12.	Cas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. HPH marker pRS316
bRA90			LEU2	Haber	Rad51-mediated double-strand break repair and mismatch correction of divergent substrates. Nature. 2017 Apr 20;544(7650):377-380. doi: 10.1038/nature22046. Epub 2017 Apr 12.	Cas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. LEU2 marker pRS316
bRA66			Hygromycin	Haber	Rad51-mediated double-strand break repair and mismatch correction of divergent substrates. Nature. 2017 Apr 20;544(7650):377-380. doi: 10.1038/nature22046. Epub 2017 Apr 12.	GAL1 driven Cas9. gRNA can be cloned into BplI sites. pRS316
bRA77			LEU2	Haber	Rad51-mediated double-strand break repair and mismatch correction of divergent substrates. Nature. 2017 Apr 20;544(7650):377-380. doi: 10.1038/nature22046. Epub 2017 Apr 12.	GAL1 driven Cas9. gRNA can be cloned into BplI sites. pRS316
pJH2970			HIS3	Haber	Cas9-mediated gene editing in Saccharomyces cerevisiae Protocol Exchange (2017)	Cas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. HIS3MX marker pRS316
pJH2971			Neomycin (select with G418)	Haber	Cas9-mediated gene editing in Saccharomyces cerevisiae Protocol Exchange (2017)	Cas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. KANMX marker pRS316
pJH2972			URA3	Haber	Cas9-mediated gene editing in Saccharomyces cerevisiae Protocol Exchange (2017)	Cas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. URA3MX marker pRS316
pUDP004		ScTDH3	amdS (acetamidase gene conferring growth on acetamide)	Daran	CRISPR-Cas9 mediated gene deletions in lager yeast Saccharomyces pastorianus. Microb Cell Fact. 2017 Dec 5;16(1):222. doi: 10.1186/s12934-017-0835-1.	E. coli/S. cerevisiae shuttle vector carrying amd S marker and Spcas9D147Y P411T allowing cloning of ribozyme flanked g-RNA for Cas9 editing (HH-gRNA-HDV) not applicable
pUDP012	HH-gRNA-HDV targetting SeILV6 in S. pastorianus (Saccharomyces cerevisiae)	ScTDH3, ScTDH3	amdS (acetamidase gene conferring growth on acetamide)	Daran	CRISPR-Cas9 mediated gene deletions in lager yeast Saccharomyces pastorianus. Microb Cell Fact. 2017 Dec 5;16(1):222. doi: 10.1186/s12934-017-0835-1.	E. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV) pUDP004
pUDP044	polycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus (Saccharomyces cerevisiae)	ScTDH3, ScTDH3	amdS (acetamidase gene conferring growth on acetamide)	Daran	CRISPR-Cas9 mediated gene deletions in lager yeast Saccharomyces pastorianus. Microb Cell Fact. 2017 Dec 5;16(1):222. doi: 10.1186/s12934-017-0835-1.	pUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV) pUDP004
pCSN061	S. pyogenes Cas9 codon optimized for expression in S. cerevisiae., KanMX marker expression cassette. (Other)	Heterologous promoter from K. lactis (KLLA0F20031g), Heterologous TEF1 promoter from A. gossypii.	TRP1 ; KanMX	Verwaal	CRISPR/Cpf1 enables fast and simple genome editing of Saccharomyces cerevisiae. Yeast. 2017 Sep 8. doi: 10.1002/yea.3278.	Single copy yeast plasmid expressing Cas9 from Streptococcus pyogenes (SpCas9), codon optimized for expression in Saccharomyces cerevisiae. pRS414 NEWENTRY
pCSN067	Cpf1 from Lachnospiraceae bacterium ND2006 (LbCpf1) codon optimized for expression in S. cerevisiae. (Other), KanMX marker expression cassette. (Other)	Heterologous promoter from K. lactis (KLLA0F20031g)., Heterologous TEF1 promoter from A. gossypii.	TRP1 ; KanMX	Verwaal	CRISPR/Cpf1 enables fast and simple genome editing of Saccharomyces cerevisiae. Yeast. 2017 Sep 8. doi: 10.1002/yea.3278.	Single copy yeast plasmid expressing Cpf1 from Lachnospiraceae bacterium ND2006 (LbCpf1), codon optimized for expression in Saccharomyces cerevisiae. pRS414
pCSN068	Cpf1 from Francisella novicida U112 (FnCpf1) codon optimized for expression in S. cerevisiae. (Other), KanMX marker expression cassette. (Other)	Heterologous promoter from K. lactis (KLLA0F20031g)., Heterologous TEF1 promoter from A. gossypii.	TRP1 ; KanMX	Verwaal	CRISPR/Cpf1 enables fast and simple genome editing of Saccharomyces cerevisiae. Yeast. 2017 Sep 8. doi: 10.1002/yea.3278.	Single copy yeast plasmid expressing Cpf1 from Francisella novicida U112 (FnCpf1), codon optimized for expression in Saccharomyces cerevisiae. pRS414
pUDE731	Fncpf1 (Other)	TEF1	URA3	Daran	FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. Nucleic Acids Research (2017), gkx1007	S. cerevisiae Episomal plasmid harboring Fncpf1 under the control of TDH3p pMEL10
pUDC175	Fncpf1 (Other)	TEF1	TRP1	Daran	FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. Nucleic Acids Research (2017), gkx1007	S. cerevisae centromic plasmid harboring Fncpf1 under control of TEF1 promoter p414TEF1
pUDP002	hph (Other), Spcas9 D147Y P411T (Other)	Ashbya gossypii (Eremothecium gossypii) TEF1, Arxula adeninivorans TEF1	Hygromycin	Daran	Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA co-expression plasmid. FEMS Yeast Res. 2018 May 1;18(3). pii: 4847887. doi: 10.1093/femsyr/foy012.	Broad-host-range Cas9/gRNA co-expression backbone plasmid (no gRNA) not applicable
BB3cN_pGAP_23*_pLAT1_Cas9	HH - FS23 linker - HDV (Other), human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS) (Homo sapiens)		NTC	Gasser	CRISPR/Cas9-mediated homology directed genome editing in Pichia pastoris (unpublished)	hCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on NTC Episomal ARS/CEN Backbone
BB3cH_pGAP_23*_pLAT1_Cas9	HH - FS23 linker - HDV (Other), human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS) (Homo sapiens)		Hygromycin	Gasser	CRISPR/Cas9-mediated homology directed genome editing in Pichia pastoris (unpublished)	hCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on Hyg Episomal ARS/CEN Backbone
BB3cK_pGAP_23*_pLAT1_Cas9	HH - FS23 linker - HDV (Other), human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS) (Homo sapiens)		Neomycin (select with G418)	Gasser	CRISPR/Cas9-mediated homology directed genome editing in Pichia pastoris (unpublished)	hCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418 Episomal ARS/CEN Backbone
BB3cK_pGAP_23*_pTEF_Cas9	HH - FS23 linker - HDV (Other), human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS) (Homo sapiens)		Neomycin (select with G418)	Gasser	CRISPR/Cas9-mediated homology directed genome editing in Pichia pastoris (unpublished)	hCas9 under control of Tef1 for direct cloning of HH-sgRNA-HDV PCR products and episomal expression in P. pastoris and G418 selection Episomal ARS/CEN Backbone
BB3cK_pGAP_23*_pPFK300_Cas9	HH - FS23 linker - HDV (Other), human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS) (Homo sapiens)		Neomycin (select with G418)	Gasser	CRISPR/Cas9-mediated homology directed genome editing in Pichia pastoris (unpublished)	hCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418 Episomal ARS/CEN Backbone
BB3cN_pGAP_23*_pPFK300_Cas9	HH - FS23 linker - HDV (Other), human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS) (Homo sapiens)		NTC	Gasser	CRISPR/Cas9-mediated homology directed genome editing in Pichia pastoris (unpublished)	hCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on NTC Episomal ARS/CEN Backbone
BB3cH_pGAP_23*_pPFK300_Cas9	HH - FS23 linker - HDV (Other), human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS) (Homo sapiens)		Hygromycin	Gasser	CRISPR/Cas9-mediated homology directed genome editing in Pichia pastoris (unpublished)	hCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on Hyg Episomal ARS/CEN Backbone
pCfB4906	Cas9 (Other)		Hygromycin	Borodina	EasyCloneYALI: CRISPR/Cas9-Based Synthetic Toolbox for Engineering of the Yeast Yarrowia lipolytica. Biotechnol J. 2018 Jan 29. doi: 10.1002/biot.201700543.	EasyCloneYALI system-based yeast integrative vector expressing Cas9 carrying hygromycin resistance marker, integration into Yarrowia lipolytica chromosomal location IntB, amp resistance Unknown
pCfB6364	Cas9 (Other)		D-serine marker; enables growth on D-serine	Borodina	EasyCloneYALI: CRISPR/Cas9-Based Synthetic Toolbox for Engineering of the Yeast Yarrowia lipolytica. Biotechnol J. 2018 Jan 29. doi: 10.1002/biot.201700543.	EasyCloneYALI system-based yeast integrative vector expressing Cas9 carrying D-serine marker, integration into Yarrowia lipolytica ku70 locus, amp resistance Unknown
pV1025	CaCas9 (Synthetic)		Ampicillin	Fink	A CRISPR system permits genetic engineering of essential genes and gene families. Sci Adv. 2015;1(3):e1500248.	Expression of Candida albicans codon-optimized Cas9 (CaCas9) - integrates at ENO1 (Part of Duet system) pV941
pV1093	CaCas9/sgRNA-BsmBI stuffer (Synthetic)		clonNAT	Fink	A CRISPR system permits genetic engineering of essential genes and gene families. Sci Adv. 2015;1(3):e1500248.	CaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1 pV1088/pV1090
pV1200	CaCas9/sgRNA-BsmBI stuffer (Synthetic)		Ampicillin	Fink	A CRISPR system permits genetic engineering of essential genes and gene families. Sci Adv. 2015;1(3):e1500248.	CaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1 - Recyclable for serial mutagenesis (Sap2-FLP) pV1025/pV1093
pV1393	CaCas9/sgRNA-BsmBI stuffer (Synthetic)		Ampicillin	Fink	New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 2018 Apr 25;3(2). pii: 3/2/e00154-18. doi: 10.1128/mSphere.00154-18. Print 2018 Apr 25.	CaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - inserts at Neut5L - Recyclable for serial mutagenesis (Sap2-FLP) pV1390
pV1524	CaCas9/sgRNA-BsmBI stuffer (Synthetic)		Ampicillin	Fink	New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 2018 Apr 25;3(2). pii: 3/2/e00154-18. doi: 10.1128/mSphere.00154-18. Print 2018 Apr 25.	CaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - inserts at Neut5L - Recyclable for serial mutagenesis (Mal2-FLP) pV1393
pV1539	CaCas9/sgRNA-BsmBI stuffer (Synthetic)		Ampicillin	Fink	New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 2018 Apr 25;3(2). pii: 3/2/e00154-18. doi: 10.1128/mSphere.00154-18. Print 2018 Apr 25.	Genedrive entry vector for Candida albicans pV1524
pV1326	CaCas9/sgRNA-BsmBI stuffer (Synthetic)		URA3 ; clonNAT	Fink	New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 2018 Apr 25;3(2). pii: 3/2/e00154-18. doi: 10.1128/mSphere.00154-18. Print 2018 Apr 25.	S. cerevisiae and C. glabrata Solo CRISPR vector, marked with URA3 and NatR pRS416
pV1382	CaCas9/sgRNA-BsmBI stuffer (Synthetic)		URA3 ; clonNAT	Fink	New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 2018 Apr 25;3(2). pii: 3/2/e00154-18. doi: 10.1128/mSphere.00154-18. Print 2018 Apr 25.	S. cerevisiae and C. glabrata Solo CRISPR vector, marked with URA3 and NatR pRS416
pV1464	CaCas9/sgRNA-BsmBI stuffer (Synthetic)		URA3 ; clonNAT	Fink	New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 2018 Apr 25;3(2). pii: 3/2/e00154-18. doi: 10.1128/mSphere.00154-18. Print 2018 Apr 25.	N. castellii Solo CRISPR vector, marked with URA3 and NatR pRS416

Zebrafish

Plasmid	Gene/Insert	Promoter	Selectable Marker	PI	Publication	Hidden Extra Search Info
MLM3613	Streptococcus pyogenes Cas9	CMV		Joung	Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.	Expresses Cas9 nuclease (Streptococcus pyogenes) from CMV and T7 promoters unknown
MLM3639	Streptococcus pyogenes Cas9-3X Flag	CMV		Joung	Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.	unknown
pST1374-NLS-flag-linker-Cas9	Human codon optimized Cas9	CMV	Blasticidin	Huang	Generation of gene-modified mice via Cas9/RNA-mediated gene targeting. Cell Res. 2013 Apr 2. doi: 10.1038/cr.2013.46.	pST1374 (Addgene #13426)
pT3TS-nCas9n	Cas9 (Synthetic)	T3		Chen	Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.	pT3T7
pCS2-Cas9	Cas9 (Other)	SP6		Schier	Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One. 2014 May 29;9(5):e98186. doi: 10.1371/journal.pone.0098186. eCollection 2014.	For in vivo expression of Cas9 or generation of Cas9 mRNA pCS2
pCS2-nCas9n	nls-zcas9-nls (Synthetic)	CMV		Chen	Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.	expression of an optimized Cas9 for genome-editing in zebrafish pCS2+
pCS2+hSpCas9	humanized S.pyogenes Cas9	SP6		Kinoshita	Targeted mutagenesis using CRISPR/Cas system in medaka. Biol Open. 2014 Apr 11;3(5):362-71. doi: 10.1242/bio.20148177.	Encode hSpCas9 for in vitro transcription with Sp6 pCS2
pCS2-nCas9n-nanos 3’UTR	nanos 3' UTR (Danio rerio)	SP6		Giraldez	CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat Methods. 2015 Aug 31. doi: 10.1038/nmeth.3543.	expression of a germ-line targeted, codon optimized Cas9 for genome-editing in zebrafish pCS2-nCas9n nanos3 cb725, nanos, nanos1, nos1
pME-Cas9	Cas9 (Danio rerio)			Zon	A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish. Dev Cell. 2015 Mar 4. pii: S1534-5807(15)00075-1. doi: 10.1016/j.devcel.2015.01.032.	Middle Entry clone for Gateway containing a zebrafish codon-optimized Cas9 flanked by 2 NLS pME-MCS (Tol2Kit #237)
pME-Cas9-T2A-GFP	Cas9-T2A-GFP (Danio rerio)			Zon	A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish. Dev Cell. 2015 Mar 4. pii: S1534-5807(15)00075-1. doi: 10.1016/j.devcel.2015.01.032.	Middle Entry clone for Gateway containing a zebrafish codon-optimized Cas9 flanked by 2 NLS and followed by inframe GFP. Cas9 and GFP are separated by the sequence of a T2A self-cleaving peptide. pME-MCS (Tol2Kit #237)
pME-Cas9	codon optimized Cas9 (Other)			Chen	Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 2015 Apr 8. pii: genetics.115.176917.	expresses codon optimized Cas9 in zebrafish pME-MCS
pUAS:Cas9T2AGFP;U6:sgRNA1;U6:sgRNA2	5x UAS (Saccharomyces cerevisiae), Cas9 (Other), T2A, GFP, U6 promoter (Danio rerio)			Del Bene	2C-Cas9: a versatile tool for clonal analysis of gene function. Genome Res. 2016 Mar 8.	Tissue-specific knock-out in zebrafish, Cas9 and GFP driven by a UAS promoter pminiTol2
pUAS:Cas9T2ACre;U6:sgRNA1;U6:sgRNA2	5xUAS, Cas9, Cre, U6 promoter			Del Bene	2C-Cas9: a versatile tool for clonal analysis of gene function. Genome Res. 2016 Mar 8.	Tissue-specific knock-out in zebrafish, Cas9 and Cre driven by a UAS promoter pminiTol2
pMJ922	SpCas9 (Other)	T7		Jinek	Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes. Development. 2016 Apr 29. pii: dev.134809.	Expression of His6-MBP-tagged Cas9-NLS-EGFP protein in E. coli pET His6 MBP N10 TEV LIC cloning vector (2C-T)
pMJ923	SpCas9 (Other)	T7		Jinek	Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes. Development. 2016 Apr 29. pii: dev.134809.	Expression of His6-MBP-tagged Cas9-NLS-mCherry protein in E. coli pET His6 MBP N10 TEV LIC cloning vector (2C-T)
pT3TS-zAsCpf1	AsCpf1 (Danio rerio)			Giraldez	CRISPR-Cpf1 mediates efficient homology-directed repair and temperature-controlled genome editing. Nat Commun. 2017 Dec 8;8(1):2024. doi: 10.1038/s41467-017-01836-2.	plasmid to carry out IVT of AsCpf1 (zebrafish codon optimized) pT3TS
pME-cas9-2A-mCherry	cas9-2A-mCherry (Danio rerio)			Deng	Neutrophil-specific knockout demonstrates a role for mitochondria in regulating neutrophil motility in zebrafish. Dis Model Mech. 2018 Mar 28;11(3). pii: dmm.033027. doi: 10.1242/dmm.033027.	An entry vector with cas9 -2A-mCherry pME
pTol2-hsp70l:Cas9-t2A-GFP, 5xU6:sgRNA	5xU6:sgRNA (Danio rerio), Cas9-t2A-GFP (Danio rerio)	U6, hsp70		Schier	Simultaneous single-cell profiling of lineages and cell types in the vertebrate brain. Nat Biotechnol. 2018 Mar 28. pii: nbt.4103. doi: 10.1038/nbt.4103.	Expression of heat shock inducible Cas9-GFP and U6-driven 5 individual gRNAs for scGESTALT in zebrafish Tol2

Xenopus

	Plasmid	Gene/Insert	Promoter	Selectable Marker	PI	Publication	Hidden Extra Search Info
	pCS2-3xFLAG-NLS-SpCas9-NLS	3xFLAG-NLS-SpCas9-NLS	CMV		Chen	Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis. Development. 2014 Jan 8.	Cas9 expression plasmid pCS2+

Do you have suggestions for other plasmids that should be added to this list?

Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource!

CRISPR Plasmids: Cut

Browse CRISPR Plasmids

By Function

Genome Editing

Transcriptional Regulation

RNA Targeting

Other Applications

Screen

gRNAs

By Species

CRISPR Resources