This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CRISPR header icon CRISPR/Cas Plasmids for use in Mammals


Addgene is working with the leading scientists in the field to assemble the reagents and information you need to use the CRISPR/Cas9 technology in your own lab. The following Cas9 and gRNA expression plasmids have been designed for use in mammals.

Cut

Fully functional Cas9 enzymes designed to introduce a double-strand break (DSBs) at a specific location based on a co-expressed gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ); a mechanism which frequently causes insertions or deletions (InDels) in the DNA, possibly resulting in frameshifts. If a repair template with high homology to the DNA surrounding the DSB is introduced along with the Cas9 and gRNA plasmids, the cell may instead repair the break using homology-directed repair (HDR). HDR is much less error-prone than NHEJ and can be used to faithfully introduce specific genomic changes.

Plasmid Gene/Insert Promoter Selectable Marker PI Publication Hidden Extra Search Info
hCas9Cas9CMV Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses human codon optimized Cas9 nuclease for genome engineering pcDNA3.3-TOPO
pX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-purohumanized S. pyogenes Cas9Puromycin Zhang Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013 Jan 3. This plasmid separately encodes a human codon-optimized SpCas9, a tracrRNA and customizable crRNA. pUC ori vector
pX330-U6-Chimeric_BB-CBh-hSpCas9humanized S. pyogenes Cas9CBh Zhang Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013 Jan 3. A human codon-optimized SpCas9 and chimeric guide RNA expression plasmid. pUC ori vector
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)
  • pMJ920Cas9 (Synthetic)CMV Doudna RNA-programmed genome editing in human cells. elife. 2013;2:e00471. doi: 10.7554/eLife.00471. Epub 2013 Jan 29. MacroLab 6D
    JDS246mammalian codon-optimized streptococcus pyogenes Cas9 - 3X FlagCMV Joung Joung lab unpublished CRISPR plasmids (unpublished) Expresses mammalian codon optimized Cas9 nuclease with C-term 3X FLAG from CMV and T7 promoters unknown
    p3s-Cas9HCCas9CMV Kim Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2507. pCDNA3.1
    pCas9_GFPCas9-2A-GFP (Synthetic)CAG Musunuru Cas9 GFP plamsids (unpublished) Co-expression of human codon-optimized Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells pCAG
    pST1374-NLS-flag-linker-Cas9Human codon optimized Cas9CMVBlasticidin Huang Generation of gene-modified mice via Cas9/RNA-mediated gene targeting. Cell Res. 2013 Apr 2. doi: 10.1038/cr.2013.46. pST1374 (Addgene #13426)
    pSimpleII-NLS-NmCas9-HA-NLS(s)NmCas9 (Other)EF1a Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12. This plasmid encode NmCas9 with two NLS and a HA tag pSimpleII
    pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s)NmCas9 (Other), U6pr-tracrRNA (Other)EF1a, U6 Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12. This plasmid contains expression cassette for NmCas9 with N and C NLS and an HA tag, a cassette for expression of tracrRNA, a cassette for cloning crRNA under the control of U6 promoter. pSimpleII
    pSimpleII-NmCas9-FLAGNmCas9 (Other) Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12. FLAG tagged NmCas9 with no NLS. pSimpleII
    pSpCas9 (PX165)hSpCas9 (Synthetic)Cbh Zhang Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. Human codon optimized Cas9 nuclease from Streptococcus pyogenes (Cbh-3X-FLAG-NLS-SpCas9-NLS) PX165
    pSpCas9(BB)-2A-GFP (PX458)hSpCas9 (Synthetic)Cbh Zhang Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. Cas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNA PX458
    pSpCas9(BB)-2A-Puro (PX459)hSpCas9-2A-Puro (Synthetic)CbhPuromycin Zhang Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. NOTE: A new version of this plasmid is now available. See Addgene plasmid 62988. PX459
    pCAG-T3-hCAS-pACodon optimized Cas9 (Synthetic)CAG promoter Fujii Efficient generation of large-scale genome-modified mice using gRNA and CAS9 endonuclease. Nucleic Acids Res. 2013 Aug 30. Expresses CAS9 nuclease in mammalian cells. Used to modify genome of mouse embroys pCAGGS
    M-SPcasCas9 (Other)CMVNeomycin (select with G418) Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian S. pyogenes Cas9 expression, human optimized pcDNA3.3 TOPO
    M-ST1casCas9 (Other)CMVNeomycin (select with G418) Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian S. thermophilus #1 Cas9 expression, human optimized pcDNA3.3 TOPO
    M-NMcasCas9 (Other)CMVNeomycin (select with G418) Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian N. meningitidis Cas9 expression, human optimized pcDNA3.3 hygro
    pCW-Cas9humanized S. pyogenes Cas9Tet ONPuromycin Sabatini Genetic screens in human cells using the CRISPR-Cas9 system. Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12. Doxycycline-inducible lentiviral expression of SpCas9 pCW57.1
    pCAG-hCas9hCas9CAGNeomycin (select with G418) Hatada Generation of an ICF syndrome model by efficient genome editing of human induced pluripotent stem cells using the CRISPR system. Int J Mol Sci. 2013 Sep 30;14(10):19774-81. doi: 10.3390/ijms141019774. Expresses hCas9 under the CAG promoter for CRISPR pEGFP-N1
    lentiCRISPR v2Cas9 (Synthetic), Puromycin resistanceEFS-NS, EFS-NSPuromycin Zhang Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. Replaces original lentiCRISPRv1 (Addgene Plasmid 49535) and produces ~10-fold higher titer virus. 3rd generation lentiviral backbone. Custom
    lentiCas9-BlastCas9 (Synthetic), Blasticidin resistanceEFS-NS, EFS-NSBlasticidin Zhang Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. Expresses human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance from EFS promoter. 3rd generation lentiviral backbone. pFUGW
    pLenti-OC-IRES-BSDOCT1 (Homo sapiens), Cas9 (Other)CMVBlasticidin Wei High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 2014 Apr 9. doi: 10.1038/nature13166. To create stable cell clones with high-level expression of Cas9 and OCT1 pLenti-CMV-BSD POU2F1 OCT1, OTF1, oct-1B
    pLV hUbC-Cas9-T2A-GFPhumanized Cas9 T2A GFP (Other)hUbC Gersbach Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 2014 Aug 13. pii: gku749. 3rd generation transfer vector. Co-expresses human optimized S. pyogenes Cas9 and GFP FUGW
    pSQT834Csy4-T2A-Cas9-NLS (Homo sapiens)CAG Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Csy4 and Cas9 nuclease expression plasmid pCAG-CFP
    pSQT817Cas9CAG Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. wildtype Cas9 expression plasmid pCAG-CFP
    pL-CRISPR.EFS.GFPSpCas9 (Other), Sp sgRNA scaffold, EFS (Homo sapiens), P2A-eGFP (Synthetic)EFS, hU6 Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. EFS Promoter driven pLKO.005
    pL-CRISPR.EFS.tRFPSpCas9 (Other), Sp sgRNA scaffold, EFS (Homo sapiens), P2A-tRFP (Synthetic) Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. EFS Promoter driven pLKO.005
    pLKO5d.EFS.SpCas9.P2A.BSDSpCas9 (Other), EFS (Homo sapiens), P2A-BSD (Synthetic)Blasticidin Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter driven pLKO.005
    pL-CRISPR.SFFV.tRFPSpCas9 (Other), Sp sgRNA scaffold, SFFV (Synthetic), P2A-tRFP (Synthetic) Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter driven pLKO.005
    pL-CRISPR.SFFV.GFPSpCas9 (Other), Sp sgRNA scaffold, SFFV (Synthetic), P2A-eGFP (Synthetic) Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter driven pLKO.005
    pL-CRISPR.EFS.PACSpCas9 (Other), Sp sgRNA scaffold, EFS (Homo sapiens), P2A-PAC (Synthetic)Puromycin Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, EFS Promoter driven pLKO.005
    pL-CRISPR.SFFV.PACSpCas9 (Other), Sp sgRNA scaffold, SFFV (Synthetic), P2A-PAC (Synthetic)Puromycin Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, SFFV Promoter driven pLKO.005
    pAdSh.PGK.Cas9Human codon-optimized S. pyogenes Cas9 (Synthetic)Neomycin (select with G418) Goncalves Adenoviral vector delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi: 10.1038/srep05105. Expresses human codon-optimized S. pyogenes Cas9 from the human PGK-1 gene promoter pBR322-based pAdEasy backbone
    pLKO5d.EFS.SpCas9.P2A.PACSpCas9 (Other), EFS (Homo sapiens), P2A-PAC (Synthetic)Puromycin Ebert Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. Lentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter driven pLKO.005
    Puro-Cas9 donorhSpCas9 (Other)Puromycin Huangfu An iCRISPR Platform for Rapid, Multiplexable, and Inducible Genome Editing in Human Pluripotent Stem Cells. Cell Stem Cell. 2014 Jun 11. pii: S1934-5909(14)00205-7. doi: 10.1016/j.stem.2014.05.018. Donor vector for genomic targeting of a Tetracycline-inducible Cas9 cassette to the human AAVS1/PPP1R12C locus N/A
    pX330A-1x2humanized S. pyogenes Cas9 nuclease (Other)CBh Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector
    piCRg EntryhSpCas9 Huangfu An iCRISPR Platform for Rapid, Multiplexable, and Inducible Genome Editing in Human Pluripotent Stem Cells. Cell Stem Cell. 2014 Jun 11. pii: S1934-5909(14)00205-7. doi: 10.1016/j.stem.2014.05.018. Cas9/gRNA Entry expression plasmid Low copy
    pCAG-T3-hCASeGFP-pACAS9 (Synthetic)CAG Fujii Efficient generation of large-scale genome-modified mice using gRNA and CAS9 endonuclease. Nucleic Acids Res. 2013 Aug 30. Expresses CAS9-eGFP fusion protein in mammalian cells. pCAGGS
    Eef1a-1955/-1>nls::Cas9::nlsnls::Cas9::nls (Other)Ciinte.Eef1a (EF1alpha) -1955/-1 Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. Eef1a (EF1alpha) promoter driving nls::Cas9::nls pCESAx
    Mesp-1916/-1>nls::Cas9::nlsnls::Cas9::nls (Other)Ciinte.Mesp -1916/-1 Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. Mesp driver driving nls::Cas9::nls pCESAx
    Sox1/2/3-2373/+3>nls::Cas9::nlsnls::Cas9::nls (Other)Ciinte.Sox1/2/3 (SoxB1) -2373/+3 Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. Sox1/2/3 (SoxB1) driver driving nls::Cas9::nls pCESAx
    pHL-EF1a-SphcCas9-iP-ACRISPR Cas9 (Other)Puromycin Hotta Precise Correction of the Dystrophin Gene in Duchenne Muscular Dystrophy Patient Induced Pluripotent Stem Cells by TALEN and CRISPR-Cas9. Stem Cell Reports. 2014 Nov 25. pii: S2213-6711(14)00335-X. doi: 10.1016/j.stemcr.2014.10.013. Expresses human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene. pHL-EF1a-GW-iP-A
    pSECCCas9 (Other), CreEFS, EFS (after Cas9-2A) Jacks Rapid modelling of cooperating genetic events in cancer through somatic genome editing. Nature. 2014 Oct 22. doi: 10.1038/nature13906. 3rd generation vector. Expresses a sgRNA of interest, Cas9 and Cre pLL3.3
    PX551SpCas9 (Synthetic)pMecp2 Zhang In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nat Biotechnol. 2014 Oct 19. doi: 10.1038/nbt.3055. pAAV-pMecp2-SpCas9-spA (AAV-SpCas9). AAV plasmid expressing Cas9 in neurons under control of truncated mecp2 promoter. pAAV
    LSL-Cas9-Rosa26TVCas9 (Synthetic), EGFPCAG, CAGNeomycin (select with G418) ; DTA Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Cre-dependent Cas9 expression plasmid and targeting vector for the mouse Rosa26 locus. Cas9 expression is Cre-dependent and the targeting vector has positive (Neo) and negative (DTA) selection. Ai9
    pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNAhSaCas9 (Other), Chimeric guide for SaCas9 (Other) Zhang In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015 Apr 1. doi: 10.1038/nature14299. A single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA. pAAV
    pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpAhSaCas9 (Other) Zhang In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015 Apr 1. doi: 10.1038/nature14299. A human codon-optimized Cas9 from Staphylococcus aureus (SaCas9). pAAV
    pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNAhSaCas9 (Other), Chimeric guide for SaCas9 (Other) Zhang In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015 Apr 1. doi: 10.1038/nature14299. A single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA. pAAV
    pMuLE ENTR CMV-hCas9 R4-R3human codon optimized Cas9 (Synthetic)CMV Frew A versatile modular vector system for rapid combinatorial mammalian genetics. J Clin Invest. 2015 Mar 9. pii: 79743. doi: 10.1172/JCI79743. MuLE (Multiple Lentiviral Expression) Entry vector containing CMV promoter and human codon optimized Cas9 module Compatible with MultiSite Gateway cloning N/A
    pMuLE ENTR SV40-hCas9 L3-L2human codon optimized Cas9 (Synthetic)SV40 Frew A versatile modular vector system for rapid combinatorial mammalian genetics. J Clin Invest. 2015 Mar 9. pii: 79743. doi: 10.1172/JCI79743. MuLE (Multiple Lentiviral Expression) Entry vector containing SV40 promoter and human codon optimized Cas9 module. Compatible with MultiSite Gateway cloning N/A
    pMuLE ENTR SV40-hCas9 L5-L2human codon optimized Cas9 (Synthetic)SV40 Frew A versatile modular vector system for rapid combinatorial mammalian genetics. J Clin Invest. 2015 Mar 9. pii: 79743. doi: 10.1172/JCI79743. MuLE (Multiple Lentiviral Expression) Entry vector containing SV40 promoter and human codon optimized Cas9 module. Compatible with MultiSite Gateway cloning N/A
    c3GIC9humanized S. Pyogenes Cas9 (Other)TRE3G Dow Inducible in vivo genome editing with CRISPR-Cas9. Nat Biotechnol. 2015 Apr;33(4):390-4. doi: 10.1038/nbt.3155. Epub 2015 Feb 18. col1a1 targeting vector for inducible [TRE3G]-GFP-IRES-Cas9 expression. Contains NsiI cloning site for U6-sgRNA cassettes col1a1 Flp-in targeting construct
    ptreCas9-mKate2ps-T1gRNACas9–mKate2ps (Synthetic) Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. Inducible; gRNA seq is ATGAGAATCAAGGCGGTCGA pTag-CFP
    pCas9–mKate2ps–EgRNACas9–mKate2ps (Synthetic) Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. Empty; no U6 gRNA cassette pTag-CFP
    pCas9–mKate2ps–T1gRNACas9–mKate2ps (Synthetic) Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. t1 gRNA (ATGAGAATCAAGGCGGTCGA) pTag-CFP
    PX851SpCas9 (aa 2-535)CBh Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. N-term SpCas9 piece of inducible split-4 (Cas9(N)-FRB-NES split-4). PX330
    PX852SpCas9 (aa536-1368)CBh Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. C-term SpCas9 piece of inducible split-4 (Cas9(C)-FKBP split-4). PX330
    PX853SpCas9 (aa 2-573)CBh Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. N-term SpCas9 piece of inducible split-5 (Cas9(N)-FRB-NES split-5). PX330
    PX854SpCas9 (aa573-1368)CBh Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. C-term SpCas9 piece of inducible split-5 (Cas9(C)-FKBP split-5). PX330
    pLSC-5SpCas9(574-1368), SpCas9(2-573)EFS, EFSPuromycin Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. Lenti vector for expression of inducible split Cas9 lentiCRISPR
    pSpCas9(BB)-2A-Puro (PX459) V2.0hSpCas9-2A-Puro V2.0 (Synthetic)CbhPuromycin Zhang Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. Cas9 from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0) PX459
    lentiCas9-EGFPCas9 (Synthetic), EGFP (Other)EFS-NS, EFS-NS Zhang Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis. Cell. 2015 Mar 12;160(6):1246-60. doi: 10.1016/j.cell.2015.02.038. Epub 2015 Mar 5. Expresses human codon-optimized S. pyogenes Cas9 protein and EGFP from EFS promoter. 3rd generation lentiviral backbone. pFUGW
    pX330S-2-PITChhumanized S. pyogenes Cas9 (Other)CBh Yamamoto MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc. 2016 Jan;11(1):118-33. doi: 10.1038/nprot.2015.140. Epub 2015 Dec 17. Expresses Cas9 nuclease and the PITCh-gRNA pUC ori vector
    pX330A-FBL/PITChhumanized S. pyogenes Cas9 (Other)CBh Yamamoto MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc. 2016 Jan;11(1):118-33. doi: 10.1038/nprot.2015.140. Epub 2015 Dec 17. Expresses Cas9 nuclease, FBL-specific gRNA, and the PITCh-gRNA pUC ori vector
    PX458_CEBPB_1gRNAU6 Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human CEBPB along with Cas9 with 2A GFP px548
    PX458_CEBPB_2gRNAU6 Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human CEBPB along with Cas9 with 2A GFP px548
    PX458_RAD21_1gRNA Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human RAD21 along with Cas9 with 2A GFP px548
    Adeno Cas9U6 and CBh Ventura In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014 Dec 18;516(7531):423-7. doi: 10.1038/nature13902. Epub 2014 Oct 22. Adenoviral vector for the expression of the Cas9 pacAd5
  • Tag / Fusion Protein
    • FLAG
  • pX333CBh; U6 Ventura In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014 Dec 18;516(7531):423-7. doi: 10.1038/nature13902. Epub 2014 Oct 22. Vector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter. pX333
  • Tag / Fusion Protein
    • 3XFLAG-Cas9 (N terminal on backbone)
  • pKMD106e - intein-Cas9(S219)mammalian codon-optimized S. pyogenes intein-Cas9(S219) - NLS - 3x FLAG (Other)CMV Liu Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol. 2015 May;11(5):316-8. doi: 10.1038/nchembio.1793. Epub 2015 Apr 6. Expresses intein-Cas9(S219) in mammalian cells pJDS246
    pKMD106h - intein-Cas9(C574)mammalian codon-optimized S. pyogenes intein-Cas9(C574) - NLS - 3x FLAG (Other)CMV Liu Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol. 2015 May;11(5):316-8. doi: 10.1038/nchembio.1793. Epub 2015 Apr 6. Expresses intein-Cas9(C574) in mammalian cells pJDS246
    pKMD111e - intein-Cas9(S219-G521R)mammalian codon-optimized S. pyogenes intein-Cas9(S219-G521R) - NLS - 3x FLAG (Other)CMV Liu Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol. 2015 May;11(5):316-8. doi: 10.1038/nchembio.1793. Epub 2015 Apr 6. Expresses intein-Cas9(S219-G521R) in mammalian cells pJDS246
    pU6-sgRosa26-1_CBh-Cas9-T2A-BFPCas9 (Other), sgRNA targeting ROSA26-1CBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked to BFP via a T2A peptide pU6-(BbsI)_CBh-Cas9-T2A-BFP
    pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI)Cas9 (Other), hU6 promoter; BbsI sites for sgRNA, H1 promoter; BamHI site for shRNACBh, U6, H1 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry via T2A pU6-(BbsI)_CBh-Cas9-T2A-BFP
    pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1BCas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNA and for Expression of Cas9 linked to BFP via T2A linked to Ad4 E1B via P2A pU6-(BbsI)_CBh-Cas9-T2A-BFP
    pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1BCas9 (Other), sgRNA targeting ROSA26-1CBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2A pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
    pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6Cas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNA and Cas9 linked via T2A to BFP linked to the Ad4 E4orf6 gene via P2A pU6-(BbsI)_CBh-Cas9-T2A-BFP
    pU6-(BbsI)_CBh-Cas9-T2A-mcherry-P2A-Ad4E1BCas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNA and for Expression of Cas9 linked via T2A to mCherry and to Ad4 E1B55K via P2A pU6-(BbsI)_CBh-Cas9-T2A-mCherry
    pU6-(BbsI)_CBh-Cas9-T2A-mcherry-P2A-Ad4E4orf6Cas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNA and for Expression of Cas9 linked via T2A to mCherry linked to the Ad4 E4orf6 gene via P2A pU6-(BbsI)_CBh-Cas9-T2A-mCherry
    PX458_GABPA_1gRNA Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human GABPA along with Cas9 with 2A GFP px548
    PX458_GABPA_2gRNA Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human GABPA along with Cas9 with 2A GFP px548
    pU6-(BbsI)_CBh-Cas9-T2A-BFPCas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to BFP via a T2A peptide pX330
    pU6-(BbsI)_CBh-Cas9-T2A-mCherryCas9 (Other), sgRNA cassetteCBh, U6 Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to mCherry via a T2A peptide pX330
    pMCS-rybozyme-IRES-CAS9CAS9 (Synthetic), HDV ribozyme (Other) Fujii Development of a mono-promoter-driven CRISPR/Cas9 system in mammalian cells. Sci Rep. 2015 Dec 16;5:18341. doi: 10.1038/srep18341. Plasmid encoding multiple cloning site, rybozyme and IRES-CAS9. pCAGGS
    PX458_ATF1_1gRNA Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human ATF1 along with Cas9 with 2A GFP px548
    pSaCas9_GFPSaCas9-2A-GFP (Synthetic)CAG Musunuru Staphylococcus aureus Cas9 (unpublished) Co-expression of human codon-optimized Staphylococcus aureus Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells and other mammalian cells pCAG
    PX458_CREB1_1gRNA Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human CREB1 along with Cas9 with 2A GFP px548
    PX458_CREB1_2gRNA Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human CREB1 along with Cas9 with 2A GFP px548
    pCas9–mKate2ps–CgRNACas9–mKate2ps Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. Control gRNA (GTCAAGGCACTCTTGCCTA) pTag-CFP
    MSCV_Cas9_puroCas9 (Synthetic)MSSV_LTRPuromycin Vakoc Discovery of cancer drug targets by CRISPR-Cas9 screening of protein domains. Nat Biotechnol. 2015 May 11. doi: 10.1038/nbt.3235. Retroviral introduction of Cas9 into mammalian cell line. MSCV_puro
    MSP469mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/R1335Q/T1337R)-NLS-3XFlag (Other)CMV & T7 Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for SpCas9 VQR variant: CMV-T7-humanSpCas9(D1135V/R1335Q/T1337R)-NLS-3xFLAG (VQR variant) JDS246
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • MSP680mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E/R1335Q/T1337R)-NLS-3XFlag (Other)CMV & T7 Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for SpCas9 EQR variant: CMV-T7-humanSpCas9(D1135E/R1335Q/T1337R)-NLS-3xFLAG (EQR variant) JDS246
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • MSP1101mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag (Other)CMV & T7 Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant) JDS246
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • MSP977mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E)-NLS-3XFlag (Other)CMV & T7 Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for SpCas9 D1135E variant: CMV-T7-humanSpCas9(D1135E)-NLS-3xFLAG JDS246
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • MSP1594mammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS (Other)CAG Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for S. thermophilus 1 Cas9: CAG-humanSt1Cas9-NLS pCAG-CFP
  • Tag / Fusion Protein
    • NLS (C terminal on insert)
  • BPK2139mammalian codon-optimized Staphylococcus aureus Cas9-NLS-3xFlag (Other)CAG Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression vector for S .aureus Cas9: CAG-humanSaCas9-NLS-3xFLAG pCAG-CFP
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3x FLAG (C terminal on insert)
  • BPK1520SpCas9 gRNA backbone, without spacer sequence (Synthetic)U6 Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNA MLM3636
    BPK2301St1Cas9 gRNA backbone, without spacer sequence (Synthetic)U6 Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. Human expression plasmid for S. thermophilus 1 Cas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-St1-sgRNA MLM3636
    VVT1SaCas9 gRNA backbone, without spacer sequence (Synthetic)U6 Joung Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jun 22. doi: 10.1038/nature14592. The Joung Lab recommends using BPK2660 (Addgene plasmid 70709) instead of VVT1 as guide RNAs cloned into BPK2660 are more effective than this plasmid. Human expression plasmid for S. aureus Cas9 sgRNA MLM3636
    pBGKCas9 Ohtsuka Mouse Genome Editing Using the CRISPR/Cas System. Curr Protoc Hum Genet. 2014 Oct 1;83:15.7.1-15.7.27. doi: 10.1002/0471142905.hg1507s83. Vector for Cas9 mRNA synthesis pcDNA3.1
    pX330.iGFP1iGFP Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for iGFP pX330
    pX330.iGFP2iGFP Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for iGFP pX330
    pX330.iGFP3iGFP Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for iGFP pX330
    pX330.iGFP5iGFP Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for iGFP pX330
    pX330.LoxPOLSL-Tomato Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for LSL pX330
    pX330.LoxPLoxP sgRNA Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for LSL pX330
    pX330.Pten.aPten deletion (Mus musculus) Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for Pten deletion pX330 Pten 2310035O07Rik, A130070J02Rik, AI463227, B430203M17Rik, MMAC1, PTENbeta, TEP1
    pX330.Pten.bPten deletion (Mus musculus) Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for Pten deletion pX330 Pten 2310035O07Rik, A130070J02Rik, AI463227, B430203M17Rik, MMAC1, PTENbeta, TEP1
    pCAS9-mCherry-Frame +0gRNA frame +0 Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint frame selector +0 pCAS9-mCherry
    pCAS9-mCherry-Frame +1gRNA frame +1 Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint frame selector +1 pCAS9-mCherry
    pCAS9-mCherry-Frame +2gRNA frame +2 Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint frame selector +2 pCAS9-mCherry
    pCAS9-mCherry-TUBBgRNA TUBB Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint target selector TUBB pCAS9-mCherry
    pCAS9-mCherry-ACTG1gRNA ACTG1 (Homo sapiens) Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint target selector ACTG1 pCAS9-mCherry
    pCAS9-mCherry-HIST1H4CgRNA HIST1H4C (Homo sapiens) Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint target selector HIST1H4C pCAS9-mCherry
    pKLV2-EF1a-BsdCas9-WEF1a-Cas9 cassette, WPRE (Homo sapiens)EF1a Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Lentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the N-terminus pKLV2 lentiviral vector
    pKLV2-U6gRNA5(Empty)-PGKGFP2ABFP-WU6gRNA cassette, PGKGFP2ABFP cassette, WPRE (Homo sapiens) Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Cas9 activity reporter (control) with GFP and BFP pKLV2 lentiviral vector
    pRosa26-EF1a-hCas9IRESneoEF1a-hCas9IRESneopA (Synthetic) Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Mouse Rosa26 targeting vector carrying the EF1a-hCas9-IRES-neo cassette pBluescriptII
    Mouse genome-wide lentiviral CRISPR gRNA library version 2U6gRNA cassette, PGKpuro2ABFP cassette, WPRE (Homo sapiens), Mouse CRISPR guide RNA library v2 (Synthetic) Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Mouse genome-wide CRISPR guide RNA library V2. (pKLV2-U6gRNA5(MouseV2)-PGKpuro2ABFP-W) pKLV2 lentiviral vector
    Human genome-wide lentiviral CRISPR gRNA library version 1U6gRNA cassette, PGKpuro2ABFP cassette, WPRE (Homo sapiens), Human CRISPR guide RNA library v2 (Synthetic) Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Human genome-wide CRISPR guide RNA library V1 (pKLV2-U6gRNA5(HumanV1)-PGKpuro2ABFP-W) pKLV2 lentiviral vector
    phumanCas9 (GB0575)Cas9 coding region (human codon optimised) (Other) Orzaez GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiol. 2013 Jul;162(3):1618-31. Provides the human codon optimized CDS of Cas9 protein as a level 0 GoldenBraid part pUPD
    PX377 Corynebacter diphtheriae Cas9CdCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Corynebacter diphtheriae Cas9 pDREAM
    PX378 Sutterella wadsworthensis Cas9SwCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Sutterella wadsworthensis Cas9 pDREAM
    PX379 Legionella pneumophila str. Paris Cas9LpCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Legionella pneumophila str. Paris Cas9 pDREAM
    PX380 Treponema denticola Cas9TdCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Treponema denticola Cas9 pDREAM
    PX381 Filifactor alocis Cas9FaCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Filifactor alocis Cas9 pDREAM
    PX382 Staphylococcus pseudintermedius Cas9SpsCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Staphylococcus pseudintermedius Cas9 pDREAM
    PX383 Lactobacillus johnsonii Cas9LjCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Lactobacillus johnsonii Cas9 pDREAM
    PX385 Streptococcus pasteurianus Cas9SpaCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Streptococcus pasteurianus Cas9 pDREAM
    PX386 Lactobacillus farciminis Cas9LfCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Lactobacillus farciminis Cas9 pDREAM
    PX387 Mycoplasma mobile Cas9MmCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Mycoplasma mobile Cas9 pDREAM
    PX388 Bacteroides coprophilus Cas9BcCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Bacteroides coprophilus Cas9 pDREAM
    PX389 Fluviicola taffensis Cas9FtCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Fluviicola taffensis Cas9 pDREAM
    PX390 Flavobacterium columnare Cas9FcCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Flavobacterium columnare Cas9 pDREAM
    PX391 Sphaerochaeta globus str. Buddy Cas9SgCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Sphaerochaeta globus str. Buddy Cas9 pDREAM
    PX392 Azospirillum B510 Cas9AzoCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Azospirillum B510 Cas9 pDREAM
    PX393 Gluconacetobacter diazotrophicus Cas9GdCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Gluconacetobacter diazotrophicus Cas9 pDREAM
    PX394 Neisseria cinerea Cas9NcCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Neisseria cinerea Cas9 pDREAM
    PX395 Roseburia intestinalis Cas9RiCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Roseburia intestinalis Cas9 pDREAM
    PX396 Parvibaculum lavamentivorans Cas9PlCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Parvibaculum lavamentivorans Cas9 pDREAM
    PX398 Nitratifractor salsuginis str DSM 16511 Cas9NsCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Nitratifractor salsuginis str DSM 16511 Cas9 pDREAM
    PX399 Mycoplasma gallisepticum str. F Cas9MgCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Mycoplasma gallisepticum str. F Cas9 pDREAM
    PX400 Campylobacter lari CF89-12 Cas9ClCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Campylobacter lari CF89-12 Cas9 pDREAM
    PX403 Streptococcus thermophilus LMD-9 CRISPR 3 Cas9St3Cas9 (Synthetic)CBh Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Streptococcus thermophilus LMD-9 CRISPR 3 Cas9 Unknown
    PX404 Campylobacter jejuni Cas9CjCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Campylobacter jejuni Cas9 Unknown
    pKLV2-EF1a-Cas9Bsd-WEF1a-Cas9 cassette, WPRE (Homo sapiens)EF1a Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Lentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the C-terminus pKLV2 lentiviral vector
    LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIRpuromycin (Synthetic), hCas9 (Synthetic)CAG, CAGPuromycin Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished) A Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expression Amp
    px330_P53 exon 8 gRNAP53 exon 8 gRNA (Synthetic)U6 Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished) px330 with gRNA towards P53 exon 8. Cas9 is expressed from a CAG promoter. amp
    px330_P53 exon 7 gRNAP53 exon 7 gRNA (Synthetic)U6 Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished) px330 with gRNA towards P53 exon 7. Cas9 is expressed from a CAG promoter. amp
    px330_SMAD exon 9 gRNASMAD exon 9 gRNA (Synthetic)U6 Elverløv-Jakobsen Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished) px330 with gRNA towards SMAD exon 9. Cas9 is expressed from a CAG promoter. amp
    CAS9PBKSCas9 (Other)CbAkt Bennett Genome editing using FACS enrichment of nuclease-expressing cells and indel detection by amplicon analysis. Nat Protoc. 2017 Mar;12(3):581-603. doi: 10.1038/nprot.2016.165. Epub 2017 Feb 16. CbAkt promoter driven Cas9-2A-GFP (from px458) pBKS
    Cas9-2A-CreCas9 and Cre recombinase (Homo sapiens)CAG Zhang Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. co-expressing Cas9 and Cre recombinase Cas9-2A-GFP
    PX405 Neisseria meningitidis Cas9NmCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Neisseria meningitidis Cas9 pDREAM
    PX406 Pasteurella multocida Cas9PmCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Pasteurella multocida Cas9 pDREAM
    PX408 Francisella tularensis subsp. novicida Cas9FtCas9 (Synthetic)CMV Zhang Feng Zhang lab bacterial Cas9 orthologs (unpublished) Francisella tularensis subsp. novicida Cas9 pDREAM
    pCSDest2-SpCas9-NLS-3XHA-NLS-Zif268Zif268 (Mus musculus) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses wild type SpCas9 fused to Zif268 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS Egr1 A530045N19Rik, ETR103, Egr-1, Krox-1, Krox-24, Krox24, NGF1-A, NGFI-A, NGFIA, TIS8, Zenk, Zfp-6, Zif268, egr
    pCSDest2-SpCas9-NLS-3XHA-NLSSpCas9 (Other) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses wild type SpCas9 in mammalian cells pCSDest2
    pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS2TS2 ZFP (Synthetic) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses wild type SpCas9 fused to ZFP-TS2 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS
    pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS3TS3 ZFP (Synthetic) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses wild type SpCas9 fused to ZFP-TS3 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS
    pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS4TS4 ZFP (Synthetic) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses wild type SpCas9 fused to ZFP-TS4 in mammalian cells pCSDest2-SpCas9-NLS-3XHA-NLS
    pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-ZFP_TS3TS3 ZFP (Synthetic) Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. Expresses R1335K mutant SpCas9 fused to ZFP-TS3 in mammalian cell pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-Zif268
    pY004 (pcDNA3.1-hFnCpf1)hFnCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized FnCpf1 pcDNA3.1
    pY005 (pcDNA3.1-hLb3Cpf1)hLb3Cpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized Lb3Cpf1 pcDNA3.1
    pY006 (pcDNA3.1-hBpCpf1)hBpCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized BpCpf1 pcDNA3.1
    pY007 (pcDNA3.1-hPeCpf1)hPeCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized PeCpf1 pcDNA3.1
    pY008 (pcDNA3.1-hPbCpf1)hPbCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized LPbCpf1 pcDNA3.1
    pY009 (pcDNA3.1-hSsCpf1)hSsCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized SsCpf1 pcDNA3.1
    pY010 (pcDNA3.1-hAsCpf1)hAsCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized AsCpf1 pcDNA3.1
    pY011 (pcDNA3.1-hLb2Cpf1)hLb2Cpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized Lb2Cpf1 pcDNA3.1
    pY012 (pcDNA3.1-hCMtCpf1)hCMtCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized CMtCpf1 pcDNA3.1
    pY013 (pcDNA3.1-hEeCpf1)hEeCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized EeCpf1 pcDNA3.1
    pY014 (pcDNA3.1-hMbCpf1)hMbCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized MbCpf1 pcDNA3.1
    pY015 (pcDNA3.1-hLiCpf1)hLiCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized LiCpf1 pcDNA3.1
    pY016 (pcDNA3.1-hLbCpf1)hLbCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized LbCpf1 pcDNA3.1
    pY017 (pcDNA3.1-hPcCpf1)hPcCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized PcCpf1 pcDNA3.1
    pY018 (pcDNA3.1-hPdCpf1)hPdCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized PdCpf1 pcDNA3.1
    pY019 (pcDNA3.1-hPmCpf1)hPmCpf1 (Other)CMVNeomycin (select with G418) Zhang Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. Expresses humanized PmCpf1 pcDNA3.1
    FUCas9Cherryhumanised S.pyogenes cas9 (Other)hUbC Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26. Expresses Cas9 with fluorescent Cherry reporter FUGW
    lentiCas9-VenusCas9 (Synthetic), Venus Reporter (Synthetic)EFS-NS, P2AVenus Bauer BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature. 2015 Sep 16. doi: 10.1038/nature15521. Expresses human codon-optimized S. pyogenes Cas9 protein and Venus reporter from EFS promoter. Lentiviral backbone. pFUGW
    MSP1830mammalian codon-optimized KKH variant Staphylococcus aureus Cas9(E782K/N968K/R1015H)-NLS-3xFlag (Other)CAG Joung Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. 2015 Nov 2. doi: 10.1038/nbt.3404. Human expression plasmid for SaCas9 KKH variant: CAG-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG pCAG-CFP
    spCas9-BlastR (pCBhCas9-BlastR)spCas9CBhBlasticidin Sherwood Cloning-free CRISPR. Stem Cell Reports. 2015 Oct 27. pii: S2213-6711(15)00284-2. doi: 10.1016/j.stemcr.2015.09.022. Expresses SpCas9 and Blasticidin resistance p2Tol2
    pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)humanized S. pyogenes Cas9 fused to human Geminin (Homo sapiens)CBh Draetta Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair. Cell Rep. 2016 Feb 3. pii: S2211-1247(16)00040-1. doi: 10.1016/j.celrep.2016.01.019. A human codon-optimized SpCas9 fused to first 110 amino acids of human GEMININ and chimeric guide RNA expression plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 GMNN Gem, MGORS6
    eSpCas9(1.1)enhanced specificity Cas9 (1.1) (Other)CBh Zhang Rationally engineered Cas9 nucleases with improved specificity. Science. 2015 Dec 1. pii: aad5227. Expresses high specificity SpCas9. Px330-like plasmid. pX330-U6-Chimeric_BB-CBh-hSpCas9
    pCR1002T7pr_10xHis-MBP-TEV-SPyCas9 Corn Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 2016 Jan 20. doi: 10.1038/nbt.3481. Express Streptococcus pyogenes Cas9 SPynCas9
    VP12mammalian codon-optimized Streptococcus pyogenes Cas9 HF1(N497A/R661A/Q695A/Q926A)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-HF1 variant: CMV-T7-humanSpCas9-HF1(N497A, R661A, Q695A, Q926A)-NLS-3xFLAG JDS246
    MSP2135mammalian codon-optimized Streptococcus pyogenes Cas9 HF2(N497A/R661A/Q695A/Q926A/D1135E)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-HF2 variant: CMV-T7-humanSpCas9-HF2(N497A, R661A, Q695A, Q926A, D1135E)-NLS-3xFLAG JDS246
    MSP2133mammalian codon-optimized Streptococcus pyogenes Cas9 HF4(Y450A/N497A/R661A/Q695A/Q926A)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-HF4 variant: CMV-T7-humanSpCas9-HF4(Y450A, N497A, R661A, Q695A, Q926A)-NLS-3xFLAG JDS246
    MSP2440mammalian codon-optimized Streptococcus pyogenes Cas9 VQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/R1335Q/T1337R)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-VQR-HF1 variant: CMV-T7-humanSpCas9-VQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, R1335Q, T1337R)-NLS-3xFLAG JDS246
    BPK2797mammalian codon-optimized Streptococcus pyogenes Cas9 VRQR(D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-VRQR variant: CMV-T7-humanSpCas9-VRQR(D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAG JDS246
    MSP2443mammalian codon-optimized Streptococcus pyogenes Cas9 VRQR-HF1(N497A/R661A/Q695A/Q926A/D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9-VRQR-HF1 variant: CMV-T7-humanSpCas9-VRQR-HF1(N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAG JDS246
    pCas9-polyACas9-polyadenine (Other)T7 Mashimo ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 2016 Jan 20;7:10431. doi: 10.1038/ncomms10431. express hCas9 byT7 promoter with polyadenine tails pcDNA3.3-TOPO
    MSP2372mammalian codon-optimized Streptococcus pyogenes Cas9 (R661A/Q695A/Q926A)-NLS-3xFlag (Other)CMV Joung High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. 2016 Jan 6. doi: 10.1038/nature16526. Human expression plasmid for SpCas9(R661A/Q695A/Q926A) variant: CMV-T7-humanSpCas9(R661A, Q695A, Q926A)-NLS-3xFLAG JDS246
    Lenti‐Cas9‐2A‐BlastCas9 (Synthetic)EFS-NSBlasticidin Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25. Lentiviral vector expressing human codon-optimized S. pyogenes FLAG-tagged Cas9 and blasticidin resistance from EFS promoter lenti CRISPR pXPR_001
    pAAVS1-PDi-CRISPRnCas9 (Synthetic), rtTA (Synthetic)TRE, CAGPuromycin Conklin CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10. Dox-inducible CRISPR nuclease (CRISPRn) knock in construct into the AAVS1 locus pAAVS1
    pAWp30EFSp-Cas9-P2A-Zeo Lu Multiplexed barcoded CRISPR-Cas9 screening enabled by CombiGEM. Proc Natl Acad Sci U S A. 2016 Feb 10. pii: 201517883. pFUGW-EFSp-Cas9-P2A-Zeo pFUGW
    pTE4396As crRNA, AsCpf1human U6, CMVNeomycin (select with G418) Welker Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. Expresses human codon-optimized AsCpf1 and As crRNA. pcDNA3.1
    pTE4398Lb crRNA, LbCpf1human U6, CMVNeomycin (select with G418) Welker Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. Expresses human codon-optimized LbCpf1 and Lb crRNA. pcDNA3.1
    pBLO1811_Cas9_noNLS_humanCas9 (Homo sapiens) Savage Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528. Human codon optimized plasmid to express Cas9 t2a mCherry w/o NLS and a sgRNA px330
    pBLO1806_Cas9_2xNLS_humanCas9 (Homo sapiens) Savage Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528. Human codon optimized plasmid to express Cas9 t2a mCherry w/2xNLS and a sgRNA px330
    pLentiCRISPR-EGFP Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. Derived from LentiCRISPR v1 but expresses EGFP instead of puromycin resistance lentiCRISPRv1
  • Tag / Fusion Protein
    • EGFP
  • pLentiCRISPR-tagBFP Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. Derived from LentiCRISPR v1 but expresses tagBFP instead of puromycin resistance lentiCRISPRv1
  • Tag / Fusion Protein
    • tagBFP
  • pLentiCRISPR-mCherry Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. Derived from LentiCRISPR v1 but expresses mCherry instead of puromycin resistance. 3rd generation. lentiCRISPRv1
  • Tag / Fusion Protein
    • mCherry
  • pLentiCRISPR-RFP657 Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. Derived from LentiCRISPR v1 but expresses RFP657 instead of puromycin resistance lentiCRISPRv1
  • Tag / Fusion Protein
    • RFP657
  • FUG-T2A-Cas9Cas9Ubiquitin Luikart A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611. Ubiquitin promoter expresses GFP and humanized spCas9 (from PX330) via a T2A motif. For cell transfection or use in lentiviral packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL. FUGW
    pRubiC-T2A-Cas9Cas9Ubiquitin Luikart A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611. Ubiquitin promoter expresses mCherry and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL. pRubi
    pRubiG-T2A-Cas9Cas9Ubiquitin Luikart A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611. Ubiquitin promoter expresses GFP and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL. pRubi
    PXLCas9U6 Luikart A Retroviral CRISPR-Cas9 System for Cellular Autism-Associated Phenotype Discovery in Developing Neurons. Sci Rep. 2016 May 10;6:25611. doi: 10.1038/srep25611. PX330 derived. Bbs1 & annealed oligos to insert guide strand. BstB1+Pac1 of PXL and FUX-/pRubiX- T2A-Cas9 for choice of sgRNA, viral backbone, and fluorescent protein. Pac1 to introduce 2nd sgRNA. PX330
    pX330-BsaIx2-DD-Cas9DD-SpCas9 (Other)CAG Calos In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining. Nucleic Acids Res. 2016 Jan 13. pii: gkv1542. Expresses DD-SpCas9 in mammalian cells and has a cloning site for an sgRNA. The FKBP12 L106P destabilization domain allows for inducible stabilization of Cas9 through the addition of Shield-1 modified pX330
    pCas9-VRER_2A_GFPCas9-VRER (Synthetic)CAG Tessier-Lavigne Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9. Nature. 2016 May 5;533(7601):125-9. doi: 10.1038/nature17664. Epub 2016 Apr 27. Cas9 VRER variant that detects NGCG PAM, combined with 2A_GFP for expression control pCAG
    pXPR_BRD111Cas9Blasticidin Hahn Integrated genetic and pharmacologic interrogation of rare cancers. NATURE COMMUNICATIONS 7:11987 Expresses Cas9 with the pLX311 backbone pLX311
    CAG-Cas9-T2A-EGFP-ires-puroWT SpCas9-T2A-EGFP-ires-puromycin resistance (Other)CAGPuromycin Otonkoski An Activating STAT3 Mutation Causes Neonatal Diabetes through Premature Induction of Pancreatic Differentiation Cell Reports 2017, 19: 281–294 Expresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter. PyCAG
    pLentiCas9-T2A-BFPT2A-BFPIn frame with Cas9Blasticidin Guigo Scalable Design of Paired CRISPR Guide RNAs for Genomic Deletion. PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar. Cas9 protein with BFP Lenti-Cas9-blast
    pLentiCas9-T2A-GFPT2A-GFPIn frame with Cas9Blasticidin Guigo Scalable Design of Paired CRISPR Guide RNAs for Genomic Deletion. PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar. Cas9 protein with GFP Lenti-Cas9-blast
    pZac2.1 SV40-CMV-SaCas9-3xNLSSV40-CMV-SaCas9-3xNLS (Synthetic)SV40, CMV promoters Wagers In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31. AAV vector containing SaCas9 pZac2.1
    BPK3079AsCpf1 crRNA backbone, without spacer sequence (Synthetic)U6 Joung Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nat Biotechnol. 2016 Jun 27. doi: 10.1038/nbt.3620. Human expression plasmid for AsCpf1 guide RNA (need to clone in spacer into BsmBI sites) MLM3636
    BPK3082LbCpf1 crRNA backbone, without spacer sequence (Synthetic)U6 Joung Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nat Biotechnol. 2016 Jun 27. doi: 10.1038/nbt.3620. Human expression plasmid for LbCpf1 guide RNA (need to clone in spacer into BsmBI sites) MLM3636
    SQT1659mammalian codon-optimized Acidaminococcus sp. BV3L6 Cpf1-NLS-3xHA (Other)CAG Joung Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nat Biotechnol. 2016 Jun 27. doi: 10.1038/nbt.3620. Human expression plasmid for AsCpf1-NLS-3xHA pCAG-GFP
    SQT1665mammalian codon-optimized Lachnospiraceae bacterium ND2006 Cpf1-NLS-3xHA (Other)CAG Joung Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nat Biotechnol. 2016 Jun 27. doi: 10.1038/nbt.3620. Human expression plasmid for LbCpf1-NLS-3xHA pCAG-GFP
    pLentiCRISPR-EPuromycin Abbosh LentiCRISPR version E (unpublished) Introduce sgRNA into a lentiviral vector (LentiCRISPR V2) which contains eSpCas9 and puromycin cassette pLentiCRISPRV2
  • Tag / Fusion Protein
    • Cas9-P2A-Puro
  • pCAG-SpCas9-GFP-U6-gRNASpCas9CAG Zou pCAG-SpCas9-U6-gRNA (unpublished) All-in-one CRISPR/Cas9 vector with CAG promoter for expression in human ESC/iPSC pSpCas9(BB)-2A-GFP (PX458)
    pCAG-eCas9-GFP-U6-gRNAeSpCas9(1.1)CAG Zou pCAG-SpCas9-U6-gRNA (unpublished) All-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in human pluripotent stem cells eSpCas9(1.1)
    eSpCas9(1.1)_No_FLAGCBh Doyon A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells. Cell Rep. 2015 Oct 7. pii: S2211-1247(15)01020-7. doi: 10.1016/j.celrep.2015.09.009. FLAGless construct expressing high specificity eSpCas9(1.1). Px330-like plasmid. pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Tag / Fusion Protein
    • Untagged eSpCas9(1.1)
  • pTE4495Mb crRNA (Other), MbCpf1human U6, CMVNeomycin (select with G418) Welker mammalian expression MbCpf1 nuclease and Mb crRNA (unpublished) mammalian expression MbCpf1 nuclease and Mb crRNA pcDNA3.1
    pTE4497Fn crRNA (Other), FnCpf1human U6, CMVNeomycin (select with G418) Welker mammalian expression MbCpf1 nuclease and Mb crRNA (unpublished) mammalian expression FnCpf1 nuclease and Fn crRNA pcDNA3.1
    pDNR-SpCas9-GemSpCas9-Gem (Other)T7 Little A Cas9 Variant for Efficient Generation of Indel-Free Knockin or Gene-Corrected Human Pluripotent Stem Cells. Stem Cell Reports. 2016 Sep 13;7(3):508-17. doi: 10.1016/j.stemcr.2016.07.001. Epub 2016 Aug 4. Used for in vitro transcription of SpCas9-Gem mRNA. Cas9 is fused to Geminin peptide and is degraded during G0/G1 phases of the cell-cycle to minimize indels caused by non-homologous end joining pDNR-Dual
    pDNR-SpCas9SpCas9 (Other)T7 Little A Cas9 Variant for Efficient Generation of Indel-Free Knockin or Gene-Corrected Human Pluripotent Stem Cells. Stem Cell Reports. 2016 Sep 13;7(3):508-17. doi: 10.1016/j.stemcr.2016.07.001. Epub 2016 Aug 4. Used for in vitro transcription of SpCas9 mRNA. pDNR-Dual
    pDNR-SpCas9-Cdt1SpCas9-Cdt1 (Other) Little A Cas9 Variant for Efficient Generation of Indel-Free Knockin or Gene-Corrected Human Pluripotent Stem Cells. Stem Cell Reports. 2016 Sep 13;7(3):508-17. doi: 10.1016/j.stemcr.2016.07.001. Epub 2016 Aug 4. Used for in vitro transcription of SpCas9-Cdt1 mRNA. Cas9 is fused to Cdt1 peptide and is degraded during S/G2 phases of the cell-cycle. pDNR-Dual
    peSpCas9(1.1)-2×sgRNA (empty, donor) Nakayama Practical method for targeted disruption of cilia-related genes by using CRISPR/Cas9-mediated homology-independent knock-in system. Mol Biol Cell. 2017 Feb 8. pii: mbc.E17-01-0051. doi: 10.1091/mbc.E17-01-0051. All-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains eSpCas9(1.1) and two sgRNA expression cassettes. The first gRNA cloning site is empty. eSpCas9(1.1)
    pAAV-SMVP-Cas9NCas9N (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells. pZac2.1
    pAAV-SMVP-Cas9CCas9C (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9C in mammalian cells. pZac2.1
    pAAV-CASI-Cas9CCas9C (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9C in mammalian cells; derived from pZac2.1 with CASI promoter. pZac2.1
    pSMVP-Cas9NCas9N (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9N in mammalian cells. pMAX
    pSMVP-Cas9C-P2A-turboGFPCas9C (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9C in mammalian cells; co-expresses turboGFP. pMAX
    pSMVP-Cas9CCas9C (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9C in mammalian cells. pMAX
    pSMVP-Cas9FL-P2A-turboGFPCas9FL (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9FL in mammalian cells; co-expresses turboGFP. pMAX
    pAAV-CASI-Cas9C-P2A-turboGFPCas9C (Synthetic) Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9C in mammalian cells; co-expresses turboGFP. pZac2.1
    pRZ-CAS9-mCherryCas9 (Synthetic)CMV Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. Cas9, mCherry expression pRZ
    pCAS9-mCherry empty Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. Cas9, mCherry, and sgRNA expression pCAS9
    pCAS9-BFP empty Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. Cas9, TagBFP, and sgRNA expression pCAS9
    Construct 7 - CMVp-Cas9-3xNLS-HSVpACas9-3xNLS (Homo sapiens) Lu Continuous genetic recording with self-targeting CRISPR-Cas in human cells. Science. 2016 Aug 18. pii: aag0511. Expresses Cas9 fused to 3xNLS driven by CMV promoter. For mammalian cell expression pGL2-Luc (Addgene #26280)
    Construct 12 - hUBCp_Cas9_3xNLS_p2a_puroRCas9-3xNLS (Homo sapiens)Puromycin Lu Continuous genetic recording with self-targeting CRISPR-Cas in human cells. Science. 2016 Aug 18. pii: aag0511. Lentiviral construct for building stable cell lines expressing Cas9 via puromycin selection Lentiviral
    Construct 33 - NFKBRp_Cas9_3xNLS_p2a-puroRCas9-3xNLSPuromycin Lu Continuous genetic recording with self-targeting CRISPR-Cas in human cells. Science. 2016 Aug 18. pii: aag0511. Lentiviral construct for building stable cell lines expressing Cas9 in the presence of TNFa via puromycin selection Lentiviral
    LentiCRISPRv2CreCre Recombinase (Other)EFS (P2A) Feldser Systematic in vivo inactivation of chromatin regulating enzymes identifies Setd2 as a potent tumor suppressor in lung adenocarcinoma. Cancer Res. 2017 Feb 15. pii: canres.2159.2016. doi: 10.1158/0008-5472.CAN-16-2159. Lentiviral vector expressing Cre recombinase alongside Cas9 and an sgRNA cloning site lentiCRISPR v2 (Addgene #52961)
    LentiCRISPRv2GFPGFP (Other)EFS (P2A) Feldser Systematic in vivo inactivation of chromatin regulating enzymes identifies Setd2 as a potent tumor suppressor in lung adenocarcinoma. Cancer Res. 2017 Feb 15. pii: canres.2159.2016. doi: 10.1158/0008-5472.CAN-16-2159. Lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning site lentiCRISPR v2
    lentiCRISPR v2-BlastBlasticidin S deaminaseEF-1αBlasticidin Babu CRISPR/Cas9-based system for loss-of-function screening (unpublished) Mammalian expression of Cas9 and sgRNA scaffold lentiCRISPR v2 (#52961)
    pCW-Cas9-BlastBlasticidin S deaminasehuman phosphoglycerate kinase 1 promoterBlasticidin Babu CRISPR/Cas9-based system for loss-of-function screening (unpublished) Mammalian expression of doxycycline-inducible Cas9 pCW-Cas9 (#50661)
    pLV-U6-gRNA-UbC-DsRed-P2A-BsrDsRed-Express2, BsrhUbCBlasticidin Gersbach CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853. Lentiviral SpCas9-gRNA expression vector with DsRed-Express2-P2A-BlastR FUGW
    pLV-U6-gRNA-UbC-eGFP-P2A-BsreGFP, BsrhUbCBlasticidin Gersbach CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853. Lentiviral SpCas9-gRNA expression vector with eGFP-P2A-BlastR FUGW
    pPB-US-ECasEERT2-spCas9-ERT2 (Other)U6 (gRNA), EF1a (ERT2-Cas9-ERT2)Puromycin Chen Chen lab CRISPR plasmids (unpublished) Piggyac transposon containing tamoxifen inducible Cas9 and a gRNA cassette. Piggybac Transposon
    pCRISPR-S12hSpCas9 (Other), eGFP (Other)CMV, CMV (downstream of F2A self-cleaving peptide)Puromycin, Hygromycin Wu An episomal CRISPR/Cas9 system to derive vector-free gene modified mammalian cells. Protein Cell. 2016 Sep;7(9):689-91. doi: 10.1007/s13238-016-0299-9. To episomally express codon optimized Cas9 and chimeric guide RNA pCEP4
    pX601-mCherrymCherryT2A Kan Genome editing using CRISPR-Cas9 to create the HPFH genotype in HSPCs: An approach for treating sickle cell disease and beta-thalassemia. Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6. Staphylococcus aureus (SaCas9) conjugated with mCherry pX601
    pX601-GFPGFP (Other) Kan Genome editing using CRISPR-Cas9 to create the HPFH genotype in HSPCs: An approach for treating sickle cell disease and beta-thalassemia. Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6. Staphylococcus aureus (SaCas9) conjugated with GFP pX601
    iCasCas9 (Other)CMVOFP expression Tan A chemical-inducible CRISPR-Cas9 system for rapid control of genome editing. Nat Chem Biol. 2016 Sep 12. doi: 10.1038/nchembio.2179. Expression of SpCas9 with 4 ERT2 fusion protein and empty gRNA cassette. The activity of Cas9 can be switched on and off in human cells with 4-hydroxytamoxifen (4-HT) GeneArt CRISPR Nuclease vector with OFP reporter
    pY108 (lenti-AsCpf1)huAsCpf1 (Synthetic), puromycin resistance gene (Synthetic)EFSPuromycin Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Lenti virus delivery of AsCpf1 and crRNA guide pHKO_23
    pY109 (lenti-LbCpf1)huLbCpf1 (Synthetic), puromycin resistance gene (Synthetic)EFSPuromycin Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Lenti virus delivery of LbCpf1 and crRNA guide pHKO_23
    pY026huAsCpf1 (Synthetic)CMV Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Expresses huAsCpf1 and crRNA guide pcDNA3.1
    pY027huLbCpf1 (Synthetic)CMV Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Expresses huLbCpf1 and crRNA guide pcDNA3.1
    pY094huAsCpf1 (Synthetic), GFP (Synthetic)CMV Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Expresses huAsCpf1-T2A-GFP and crRNA guide pcDNA3.1
    pY30huAsCpf1 (Synthetic), puromycin resistance gene (Synthetic)CMVPuromycin Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Expresses huAsCpf1-P2A-puro and crRNA guide pcDNA3.1
    pY31huLbCpf1 (Synthetic), puromycin resistance gene (Synthetic)CMVPuromycin Zhang Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5. Expresses huLbCpf1-P2A-puro and crRNA guide pcDNA3.1
    Lenti-AsCpf1-BlastAsCpf1 (Other)EFS-NSBlasticidin Kim In vivo high-throughput profiling of CRISPR-Cpf1 activity. Nat Methods. 2016 Dec 19. doi: 10.1038/nmeth.4104. Expresses human codon-optimized AsCpf1 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. lentiCas9-Blast(Addgene#:52962)
    Lenti-LbCpf1-BlastLbCpf1 (Other)EFS-NSBlasticidin Kim In vivo high-throughput profiling of CRISPR-Cpf1 activity. Nat Methods. 2016 Dec 19. doi: 10.1038/nmeth.4104. Expresses human codon-optimized LbCpf1 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. lentiCas9-Blast(Addgene#:52962)
    pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova) loxP-stop-loxP (Other) Iwasato Supernova: A Versatile Vector System for Single-Cell Labeling and Gene Function Studies in vivo. Sci Rep. 2016 Oct 24;6:35747. doi: 10.1038/srep35747. This plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9. pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene Plasmid #42230)
    Lenti-iCas9-neoFlag-iCas9-P2A-GFP (Other)Neomycin (select with G418) Yan An easy and efficient inducible CRISPR/Cas9 platform with improved specificity for multiple gene targeting. Nucleic Acids Res. 2016 Nov 2;44(19):e149. Epub 2016 Jul 25. Lentiviral vector encoding a doxycycline inducible EGFP reporter downstream of FLAG-tagged spCas9, separated by a P2A self-cleavage sequence pInducer-20
    Lenti-multi-CRISPRPuromycin Yan An easy and efficient inducible CRISPR/Cas9 platform with improved specificity for multiple gene targeting. Nucleic Acids Res. 2016 Nov 2;44(19):e149. Epub 2016 Jul 25. Lentiviral vector for the delivery of multiple sgRNAs targeting different genes with constitutive Cas9 expression Lenti-CRISPR
    pAAV-RSV-SpCas9pRSV (Other)pRSV Lei The CRISPR/Cas9-created MDM2 T309G enhances vitreous-induced expression of MDM2 and proliferation and survival of cells. J Biol Chem. 2016 May 31. pii: jbc.M116.729467. Express SpCas9 in mammalian cells pAAV
    pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPREU6-modified-sgRNA-Backbone-EFS-hSaCas9-2xNLS-2A-Puro (Synthetic)Puromycin Regev A Distinct Gene Module for Dysfunction Uncoupled from Activation in Tumor-Infiltrating T Cells. Cell. 2016 Sep 8;166(6):1500-1511.e9. doi: 10.1016/j.cell.2016.08.052. Lentiviral vector encoding modified SaCas9 system backbone bearing BsmBI site for new guide RNAs and puromycin selection marker. pLKO
    FUCas9Cyanhumanised S.pyrogenes Cas9 (Other)hUBC Herold (unpublished) Expresses Cas9 with fluorescent Cyan reporter FUGW
    FUCas9GFPhumanised S.pyogenes Cas9 (Other)hUBC Herold (unpublished) Expresses Cas9 with green fluorescent reporter FUGW
    pX330-H11r1-2-DD-Cas9DD-SpCas9 (Other) Calos In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining. Nucleic Acids Res. 2016 Jan 13. pii: gkv1542. Expresses DD-SpCas9 in mammalian cells and targets the H11 locus in human cells modified pX330
    pLenti-Cas9-GFPCas9-GFP (Synthetic)EFS Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9-GFP pLentiCRISPR v1
    pY036_ATP1A1_G3_ArrayATP1A1 G3 crRNA + user-specified crRNA + AsCpf1-3xHA (Other)CBh Doyon Marker-free coselection for CRISPR-driven genome editing in human cells. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265. Vector for expression of a CRISPR/AsCpf1 array containing the ATP1A1 G3 guide in combination with a user-specified guide. Cloning of oligos for the second guide using BbsI sites. PY036-like plasmid pY036-U6-crRNA(BbsI)-CBh-AsCpf1
    pY036_ATP1A1_G5_ArrayATP1A1 G5 crRNA + user-specified crRNA + AsCpf1-3xHA (Other)CBh Doyon Marker-free coselection for CRISPR-driven genome editing in human cells. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265. Vector for expression of a CRISPR/AsCpf1 array containing the ATP1A1 G5 guide in combination with a user-specified guide. Cloning of oligos for the second guide using BbsI sites. PY036-like plasmid pY036-U6-crRNA(BbsI)-CBh-AsCpf1
    Hygro-Cas9 donorhSpCas9 (Other)Hygromycin Huangfu Genome Editing in hPSCs Reveals GATA6 Haploinsufficiency and a Genetic Interaction with GATA4 in Human Pancreatic Development. Cell Stem Cell. 2017 Feb 8. pii: S1934-5909(17)30001-2. doi: 10.1016/j.stem.2017.01.001. Donor vector for genomic targeting of a Tetracycline-inducible Cas9 cassette to the human AAVS1/PPP1R12C locus with hygromycin selection N/A
    pU6-(BbsI)sgRNA_CAG-Cas9-venus-bpACas9-venus (Synthetic)CAG Kuehn Kuehn -sgRNA plasmids (unpublished) For cloning and expression of sgRNA together with expression of a Cas9-Venus fusion protein Bluescript
    pU6-(BbsI)sgRNA_CAG-Cas9-bpA_EF1-TagRFPCas9 (Other)CAG Kuehn Kuehn -sgRNA plasmids (unpublished) For cloning and expression of sgRNA together with expression of Cas9 and TagRFP Bluescript
    pCAG-1BPNLS-Cas9-1BPNLS1BPNLS-Cas9-1BPNLS (Synthetic)CAG Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. BPNLS-Cas9-BPNLS expression plasmid pCAG
    pCAG-1BPNLS-Cas9-1BPNLS-2AGFP1BPNLS-Cas9-1BPNLS-2A-EGFP (Synthetic)CAG Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. BPNLS-Cas9-BPNLS-2AGFP expression plasmid pCAG
    pAAV-nEFCas9nEF-Cas9 (Synthetic) Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. SpCas9 expression AAV backbone plasmid under control of nEF promoter PX551
    lenti-Cas9-VQR-BlastSpCas9-VQR(D1135V,R1335Q,T1337R) (Other)Blasticidin Bauer Variant-aware saturating mutagenesis using multiple Cas9 nucleases identifies regulatory elements at trait-associated loci. Nat Genet. 2017 Feb 20. doi: 10.1038/ng.3793. lentiviral expression of SpCas9-VQR (NGA PAM restricted) lentiCas9-Blast
    P628_SpCas9-RecARecA (Synthetic)CBh Luo Fusion of SpCas9 to E. coli Rec A protein enhances CRISPR-Cas9 mediated gene knockout in mammalian cells. J Biotechnol. 2017 Mar 1;247:42-49. doi: 10.1016/j.jbiotec.2017.02.024. Human codon optimized RecA protein was fused to SpCas9 for enhanced genome editing efficiency PX459
    P823_eSpCas9(1.1)-RecARecACBh Luo Fusion of SpCas9 to E. coli Rec A protein enhances CRISPR-Cas9 mediated gene knockout in mammalian cells. J Biotechnol. 2017 Mar 1;247:42-49. doi: 10.1016/j.jbiotec.2017.02.024. Human codon optimized RecA protein was fused to eSpCas9(1.1) for enhanced genome editing efficiency eSpCas9(1.1)
    TLCV2Tight TRE promoterPuromycin Karpf Inducible LentiCRISPR v2 (unpublished) LentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression. lentiCRISPR v2
  • Tag / Fusion Protein
    • Cas9-T2A-eGFP
  • pCSDest2-NmeCas9-NLS-3XHA-NLSNme Cas9 (Other)CMV Sontheimer Naturally Occurring Off-Switches for CRISPR-Cas9. Cell. 2016 Dec 15;167(7):1829-1838.e9. doi: 10.1016/j.cell.2016.11.017. Epub 2016 Dec 8. Mammalian expression of wild type Nme Cas9 pCSDest2
    SIN-CMV-Ca9-WPREspCas9 (Other)CMV Déglon The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991 Transfer plasmid for the production of lentiviral vectors SIN lentiviral transfer vector
    SIN-PGK-Cas9-V5-WPREspCas9 (Other)mouse PGK Déglon The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991 To produce lentiviral vector for Cas9 editing SIN lentiviral transfer vector
    SIN-PGK-Cas9-WPREhCas9 (Other)mouse PGK Déglon The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991 To produce Lentiviral vector for gene editing HIV-1 lentiviral SIN transfer vector
    SIN-CMV-Cas9-V5-WPRECas9-V5 (Other)CMV Déglon The self-inactivating KamiCas9 system for the editing of CNS disease genes Cell Reports , Volume 20 , Issue 12 , 2980 - 2991 To produce lentiviral vector for gene editing HIV-1 SIN lentiviral transfer vector
    pTE4254St chimeric gRNA, hStCas9human U6, CMVNeomycin (select with G418) Welker Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. Expresses St chimeric gRNA and human codon-optimized StCas9 pcDNA3.3-TOPO
    pKS7107Nm crRNA, Nm tracrRNA, hNmCas9human U6, human U6, EF1a Welker Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. Expresses Nm crRNA, Nm tracrRNA and human codon-optimized NmCas9 pSimpleII
    pcDNA3.1-hAsCpf1(TYCV) (pY210)Acidaminococcus sp. Cpf1 (RR variant) (Synthetic)CMV Zhang Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. Expresses humanized AsCpf1 variant that recognizes TYCV PAMs pcDNA3.1
    pAsCpf1(TYCV)(BB) (pY211)Acidaminococcus sp. Cpf1 (RR variant) (Synthetic)CBh Zhang Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. Expresses humanized AsCpf1 TYCV PAM variant and crRNA guide pUC ori vector
    pcDNA3.1-hAsCpf1(TATV) (pY220)Acidaminococcus sp. Cpf1 (RVR variant) (Synthetic)CMV Zhang Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. Expresses humanized AsCpf1 variant that recognizes TATV PAMs pcDNA3.1
    pAsCpf1(TATV)(BB) (pY221)Acidaminococcus sp. Cpf1 (RVR variant) (Synthetic)CBh Zhang Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. Expresses humanized AsCpf1 TATV PAM variant and crRNA guide pUC ori vector
    pcDNA3.1-hLbCpf1(TYCV) (pY230)Lachnospiraceae bacterium Cpf1 (RR variant) (Synthetic)CMV Zhang Engineered Cpf1 variants with altered PAM specificities. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. Expresses humanized LbCpf1 variant that recognizes TYCV PAMs pcDNA3.1
    L40C-CRISPR.EFS.dTomato Heckl CRISPR-Cas9-induced t(11;19)/MLL-ENL translocations initiate leukemia in human hematopoietic progenitor cells in vivo. Haematologica. 2017 Jun 1. pii: haematol.2017.164046. doi: 10.3324/haematol.2017.164046. Lentiviral CRISPR-Cas9 delivery for sgRNA (hU6), dTomato coexpression, EFS Promoter driven SIN40C
    L40C-CRISPR.EFS.PACPuromycin Heckl CRISPR-Cas9-induced t(11;19)/MLL-ENL translocations initiate leukemia in human hematopoietic progenitor cells in vivo. Haematologica. 2017 Jun 1. pii: haematol.2017.164046. doi: 10.3324/haematol.2017.164046. Lentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), PAC (Puromycin resistance) coexpression, EFS Promoter driven SIN40C
    pRGEN-CMV-CjCas9Cas9 derived from compylobacter Jejuni (Other) Kim In vivo genome editing with a small Cas9 orthologue derived from Campylobacter jejuni. Nat Commun. 2017 Feb 21;8:14500. doi: 10.1038/ncomms14500. Expression of CjCas9 in mammalian cells pcDNA3.1
    CAG-Cas9hCas9 (Other)CAG Otonkoski Generation of an OCT4 reporter human induced pluripotent stem cell line using CRISPR/SpCas9. Stem Cell Res. 2017 Aug;23:105-108. doi: 10.1016/j.scr.2017.07.006. Epub 2017 Jul 11. Expresses high levels of WT Cas9 for genome editing pCAG
    CAG-SaCas9-WPRESaCas9 (Other)CAG Otonkoski Generation of a SOX2 reporter human induced pluripotent stem cell line using CRISPR/SaCas9. Stem Cell Res. 2017 Jul;22:16-19. doi: 10.1016/j.scr.2017.05.005. Epub 2017 May 17. Expresses high levels of WT SaCas9 for genome editing pCAG NEWENTRY
    DD-Cas9 with filler sequence and Venus (EDCPV)Cas9 (Synthetic)EFS Sordella Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization. Nat Commun. 2017 Feb 22;8:14370. doi: 10.1038/ncomms14370. This plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be remove for cloning of desired sgRNA lentiCRISPR v2
    DD-Cas9 with filler sequence and Cre-ERT2 (EDCICE)Cas9 (Synthetic)EFS Sordella Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization. Nat Commun. 2017 Feb 22;8:14370. doi: 10.1038/ncomms14370. This plasmid contains destabilized Cas9 and has Cre-ERT2 after IRES sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNA lentiCRISPR v2
    pSpCas9(BB)-2A-miRFP670hSpCas9-2A-miRFP670 (Synthetic), BB-guide RNA (Synthetic)Cbh, U6 Kuehn pSpCas9(BB)-2A-miRFP670 (unpublished) Cas9 from S. pyogenes with 2A-miRFP670, and cloning backbone for sgRNA. Modified Zhang Plasmid #62988 PX459
    HeFm1SpCas93xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity mut1 Cas9-NLS (Other)Cbh Welker Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. Expression plasmid for human codon-optimized increased fidelity HeFm1SpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
    pY111 (pcDNA3.1-huTsCpf1)huTsCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized TsCpf1 pcDNA3.1
    pY113 (pcDNA3.1-huPb2Cpf1)huPb2Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Pb2Cpf1 pcDNA3.1
    pY115 (pcDNA3.1-huMlCpf1)huMlCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized MlCpf1 pcDNA3.1
    pY116 (pcDNA3.1-huMb2Cpf1)huMb2Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Mb2Cpf1 pcDNA3.1
    pY117 (pcDNA3.1-huMb3Cpf1)huMb3Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Mb3Cpf1 pcDNA3.1
    pY118 (pcDNA3.1-huLb4Cpf1)huLb4Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Lb4Cpf1 pcDNA3.1
    pY119 (pcDNA3.1-huLb5Cpf1)huLb5Cpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized Lb5Cpf1 pcDNA3.1
    pY120 (pcDNA3.1-huFbCpf1)huFbCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized FbCpf1 pcDNA3.1
    pY122 (pcDNA3.1-huCPbCpf1)huCPbCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized CPbCpf1 pcDNA3.1
    pY123 (pcDNA3.1-huCMaCpf1)huCMaCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized CMaCpf1 pcDNA3.1
    pY124 (pcDNA3.1-huBsCpf1)huBsCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized BsCpf1 pcDNA3.1
    pY125 (pcDNA3.1-huBfCpf1)huBfCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized BfCpf1 pcDNA3.1
    pY126 (pcDNA3.1-huBoCpf1)huBoCpf1 (Other) Zhang Zhang lab Cpf1 plasmids (unpublished) Expression of humanized BoCpf1 pcDNA3.1
    pCAG Cas9-2A-CitrineCas9 2A Citrine (Other) Sauka-Spengler Genome and epigenome engineering CRISPR toolkit for probing in vivo cis-regulatory interactions in the chicken embryo BioRxiv CAG-driven ubiquitous expression of Cas9. Contains 2A-Citrine reporter. For CRISPR mediated gene knockouts in chicken embryos. pCAG
    pTK Cas9-2A-CitrineCas9 2A Citrine (Other)thymidine kinase promoter Sauka-Spengler Genome and epigenome engineering CRISPR toolkit for probing in vivo cis-regulatory interactions in the chicken embryo BioRxiv Enhancer/reporter plasmid for tissue-specific expression of Cas9 with 2A-Citrine reporter. Contains BsmBI-flanked LacZ cloning cassette for rapid GoldenGate-based cloning of specific enhancers. pTK
    pCI Cas9 H2B-RFPCas9 (Other)CAG Sauka-Spengler Genome and epigenome engineering CRISPR toolkit for probing in vivo cis-regulatory interactions in the chicken embryo BioRxiv CAG-driven ubiquitous expression of Cas9 with Histone2B-RFP reporter controlled by IRES pCI IRES H2B RFP
    pXPR_206Puromycin Root Najm et al. (unpublished) for SaCas9 knockout, lentiviral expression of SaCas9 and gRNA scaffold pXPR
    pPapiPuromycin Root Najm et al. (unpublished) lentiviral expression of SaCas9 and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in Stable SpCas9 expressing cell lines for dual Cas9 "Big Papi" screens. Alt name pXPR207. pXPR
    pLX_311-Cas9Cas9 (Other)EF1aBlasticidin Hahn Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014 Sep 3. doi: 10.1038/nbt.3026. for Cas9 knockout, lentiviral expression of Cas9. Alternate plasmid name: pXR111 pXPR
    AAV_Efs_hSpCas9_NLS_FLAG-SV40humanized S. pyogenes Cas9 (Synthetic)EFS Yang Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76. AAV vector for encoding a human codon-optimized SpCas9 driven by EFs promoter pAAV
  • Tag / Fusion Protein
    • Flag (C terminal on insert)
  • Lenti_Efs_hSpCas9_NLS_FLAG-WPREhumanized S. pyogenes Cas9 (Synthetic)EFS Yang Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76. Lentiviral vector for encoding a human codon-optimized SpCas9 driven by EFs promoter. Lenti virus
  • Tag / Fusion Protein
    • Flag (C terminal on insert)
  • LentiCRISPRv2-mCherryCas9 (Synthetic), mCherry (Other)EFS-NS, EFS-NSmCherry Smogorzewska LentiCRISPRv2-mCherry (unpublished) Lentiviral vector encoding sgRNA cloning site + hSpCAS9-P2A-mCherry. LentiCRISPRv2
    ciCas9_pcDNA5ciCas9Hygromycin Maly Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368. Expresses ciCas9 in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables. pcDNA5/FRT/TO
    e-ciCas9_pcDNA5e-ciCas9Hygromycin Maly Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368. Expresses enhanced specificity ciCas9 (e-ciCas9) in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables. pcDNA5/FRT/TO
    BPK3258 - human expression plasmid for eSpCas9(1.1)hSpCas9-eSpCas9(1.1)(K848A/K1003A/R1060A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 eSpCas9(1.1) variant: CMV-T7-hSpCas9-eSpCas9(1.1)(K848A, K1003A, R1060A)-NLS(SV40)-3xFLAG JDS246
    BPK3274 - human expression plasmid for eSpCas9(1.1)-HF1hSpCas9-eSpCas9(1.1)-HF1(N497A/R661A/Q695A/K848A/Q926A/K1003A/R1060A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant: CMV-T7-hSpCas9-eSpCas9(1.1)-HF1(N497A, R661A, Q695A, K848A, Q926A, K1003A, R1060A)-NLS(SV40)-3xFLAG JDS246
    BPK4410 - human expression plasmid for SpCas9 Cluster 1 (HypaCas9)hSpCas9-Cluster1(N692A/M694A/Q695A/H698A)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 variant (HypaCas9): CMV-T7-hSpCas9-Cluster1(N692A, M694A, Q695A, H698A)-NLS(SV40)-3xFLAG JDS246
    MMW3709 - human expression plasmid for SpCas9 Cluster 1 + Q926AhSpCas9-Cluster1+Q926A(N692A/M694A/Q695A/H698A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 + Q926A variant: CMV-T7-hSpCas9-Cluster1+Q926A(N692A, M694A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3914 - human expression plasmid for SpCas9 Cluster 1 H698 + Q926AhSpCas9-Cluster1H698+Q926A(N692A/M694A/Q695A/Q926A)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 H698 + Q926A variant: CMV-T7-hSpCas9-Cluster1H698+Q926A(N692A, M694A, Q695A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3689 - human expression plasmid for SpCas9 Cluster 1 Q695 + Q926AhSpCas9-Cluster1Q695+Q926A(N692A/M694A/H698A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 Q695 + Q926A variant: CMV-T7-hSpCas9-Cluster1Q695+Q926A(N692A, M694A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3911 - human expression plasmid for SpCas9 Cluster 1 M694 + Q926AhSpCas9-Cluster1M694+Q926A(N692A/Q695A/H698A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 M694 + Q926A variant: CMV-T7-hSpCas9-Cluster 1M694+Q926A(N692A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3909 - human expression plasmid for SpCas9 Cluster 1 N692 + Q926AhSpCas9-Cluster1N692+Q926A(M694A/Q695A/H698A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 1 N692 + Q926A variant: CMV-T7-hSpCas9-Cluster1N692+Q926A(M694A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3001 - human expression plasmid for SpCas9 Cluster 2 + Q926AhSpCas9-Cluster2+Q926A(G582A/V583A/E584A/D585A/N588A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 2 + Q926A variant: CMV-T7-hSpCas9-Cluster2+Q926A(G582A, V583A, E584A, D585A, N588A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW2993 - human expression plasmid for SpCas9 Cluster 2hSpCas9-Cluster2(G582A/V583A/E584A/D585A/N588A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 2 variant: CMV-T7-hSpCas9-Cluster2(G582A, V583A, E584A, D585A, N588A)-NLS(SV40)-3xFLAG JDS246
    MMW3645 - human expression plasmid for SpCas9 Cluster 3hSpCas9-Cluster3(T657A/G658A/W659A/R661A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 3 variant: CMV-T7-hSpCas9-Cluster3(T657A, G658A, W659A, R661A)-NLS(SV40)-3xFLAG JDS246
    MMW3629 - human expression plasmid for SpCas9 Cluster 3 + Q926AhSpCas9-Cluster3+Q926A(T657A/G658A/W659A/R661A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 3 + Q926A variant: CMV-T7-hSpCas9-Cluster3+Q926A(T657A, G658A, W659A, R661A, Q926A)-NLS(SV40)-3xFLAG JDS246
    MMW3770 - human expression plasmid for SpCas9 Cluster 4hSpCas9-Cluster4(F491A/M495A/T496A/N497A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 4 variant: CMV-T7-hSpCas9-Cluster4(F491A, M495A, T496A, N497A)-NLS(SV40)-3xFLAG JDS246
    MMW3759 - human expression plasmid for SpCas9 Cluster 4 + Q926AhSpCas9-Cluster4+Q926A(F491A/M495A/T496A/N497A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 4 + Q926A variant: CMV-T7-hSpCas9-Cluster4+Q926A(F491A, M495A, T496A, N497A, Q926A)-NLS(SV40)-3xFLAG JDS246
    BPK4387 - human expression plasmid for SpCas9 Cluster 5hSpCas9-Cluster5(K918A/V922A/R925A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 5 variant: CMV-T7-hSpCas9-Cluster5(K918A, V922A, R925A)-NLS(SV40)-3xFLAG JDS246
    BPK4393 - human expression plasmid for SpCas9 Cluster 5 + Q926AhSpCas9-Cluster5+Q926A(K918A/V922A/R925A/Q926A) (Synthetic)CMV Joung Enhanced proofreading governs CRISPR-Cas9 targeting accuracy. Nature. 2017 Sep 20. doi: 10.1038/nature24268. Human expression plasmid for SpCas9 Cluster 5 + Q926A variant: CMV-T7-hSpCas9-Cluster5+Q926A(K918A, V922A, R925A, Q926A)-NLS(SV40)-3xFLAG JDS246
    px459 VQRSpCas9 VQR (Other)Puromycin Holland AID Chapter plasmids (unpublished) sgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM) px459 v2
    px459 VRERSpCas9 VRER (Other)Puromycin Holland AID Chapter plasmids (unpublished) sgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM) px459 v2
    p458 VQRSpCas9 VQR (Other)EGFP Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifs px458
    p458 VRERSpCas9 VRER (Other)EGFP Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifs px458
    px330 VRERSpCas9 VRER (Other) Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifs px330
    p330 VQRSpCas9 VQR (Other) Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifs px330
    px458 EQRSpCas9 EQR (Other)EGFP Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifs px458
    px459 EQRSpCas9 EQR (Other)Puromycin Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifs px459 v2
    px330 EQRSpCas9 EQR (Other) Holland px458 VQR (unpublished) Expresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifs px330

    Nick

    A mutated "nickase" version of the Cas9 enzyme generates a single-strand DNA break (Nick) at a specific location based on a co-expressed gRNA-defined target sequence, rather than a double-strand DNA break (Cut) produced by the wild type enzyme. Nicks are preferentially repaired in the cell by homology directed repair (HDR), using the intact strand as the template. HDR has high fidelity and rarely results in errors. Two adjacent, opposite strand nicks can cause a double strand break (DSB) and trigger error-prone non-homologous end joining (NHEJ) repair; however, in the presence of a repair template, the double nicks can be repaired by HDR. Double nicking greatly reduces unwanted off-target effects.

    Plasmid Gene/Insert Promoter Selectable Marker Publication Hidden Extra Search Info
    hCas9_D10ACas9_D10ACMVRNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses human codon optimized Cas9 D10A mutant which functions as a nickase for genome engineering pcDNA3.3-TOPO
    pX334-U6-DR-BB-DR-Cbh-NLS-hSpCas9n(D10A)-NLS-H1-shorttracr-PGK-purohumanized S. pyogenes Cas9 (D10A) nickasePuromycinMultiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013 Jan 3. This plasmid separately encodes a human codon-optimized SpCas9 nickase, a tracrRNA and customizable crRNA. pUC ori vector
  • Tag / Fusion Protein
    • HA (N terminal on insert)
  • pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)humanized S. pyogenes Cas9 (D10A) nickaseMultiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013 Jan 3. A human codon-optimized SpCas9 nickase and chimeric guide RNA expression plasmid. pUC ori vector
  • Tag / Fusion Protein
    • HA (N terminal on insert)
  • pCas9D10A_GFPCas9D10A-2A-GFP (Synthetic)CAG Cas9 GFP plamsids (unpublished) Co-expression of human codon-optimized Cas9 (D10A) mutant nickase and GFP, plasmid optimized for expression in human pluripotent stem cells pCAG
  • Tag / Fusion Protein
    • 2A-GFP (C terminal on insert)
  • pSpCas9n(BB)-2A-GFP (PX461)hSpCas9n (Synthetic)CbhGenome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. Cas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNA PX461
    pSpCas9n(BB)-2A-Puro (PX462)hSpCas9n-2A-Puro (Synthetic)CbhPuromycinGenome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. NOTE: A new version of this plasmid is now available. See Addgene plasmid 62987 PX462
    pSpCas9n(BB) (PX460)hSpCas9n (Synthetic)CbhGenome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. Cas9n (D10A nickase mutant) from S. pyogenes PX460
    pST1374-N-NLS-flag-linker-Cas9-H840ACas9 nickaseCMVBlasticidinEfficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. Nat Methods. 2014 Mar 2. doi: 10.1038/nmeth.2857. Cas9 nickase optimized for nuclear import. Addgene 44758
    pST1374-N-NLS-flag-linker-Cas9-D10ACas9 nickaseCMVBlasticidinEfficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. Nat Methods. 2014 Mar 2. doi: 10.1038/nmeth.2857. Cas9 nickase optimized for nuclear import. Addgene 44758
    pCAG-T3-hCasD10A-pACodon-optimized Cas9 D10A (Synthetic)CAG promoterEfficient generation of genome-modified mice via offset-nicking by CRISPR/Cas system. Biochem Biophys Res Commun. 2014 Jan 31. pii: S0006-291X(14)00176-4. doi: 10.1016/j.bbrc.2014.01.141. Expresses Cas9-nickase in mammalian cells and zygotes. pCAGGS
    pCAG-hCas9D10AhCas9D10A (Other)CAGNeomycin (select with G418) pCAG-hCas9D10A (unpublished) The expression vector for humanized nickase Cas9 (Cas9D10A) under CAG promoter pEGFP-N1
    pNW3Csy4-T2A-Cas9n (D10A)CAGDimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Csy4 and Cas9 D10A nickase expression plasmid pCAG-CFP
    N-Terminal Split Cas9 D10A Nickase with GyrA inteinD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein (Homo sapiens)CBhTrans-spliced Cas9 allows cleavage of HBB and CCR5 genes in human cells using compact expression cassettes. Sci Rep. 2015 Jul 1;5:10777. doi: 10.1038/srep10777. Expresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase production Plasmid 42235: pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)
    pHL-EF1a-SphcCas9(D10A)-iP-ACRISPR Cas9 D10A (Other), puromycin resistance gene (Other)PuromycinPrecise Correction of the Dystrophin Gene in Duchenne Muscular Dystrophy Patient Induced Pluripotent Stem Cells by TALEN and CRISPR-Cas9. Stem Cell Reports. 2014 Nov 25. pii: S2213-6711(14)00335-X. doi: 10.1016/j.stemcr.2014.10.013. Expresses D10A mutant (nickase) of human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene. pHL-EF1a-GW-iP-A
    pXCas9H840ACBh and U6Systematic quantification of HDR and NHEJ reveals effects of locus, nuclease, and cell type on genome-editing Scientific Reports 6, Article number: 23549 (2016) Dual Expression Vector for Cas9 H840A nickase and gRNA pUC ori vector
  • Tag / Fusion Protein
    • 3XFLAG (N terminal on backbone)
  • c3GIC9nhumanized S. Pyogenes Cas9 (D10A) (Other)TRE3GInducible in vivo genome editing with CRISPR-Cas9. Nat Biotechnol. 2015 Apr;33(4):390-4. doi: 10.1038/nbt.3155. Epub 2015 Feb 18. col1a1 targeting vector for inducible [TRE3G]-GFP-IRES-Cas9n (D10A variant) expression. Contains NsiI cloning site for U6-sgRNA cassettes col1a1 Flp-in targeting construct
    pSpCas9n(BB)-2A-Puro (PX462) V2.0hSpCas9n-2A-Puro (Synthetic)PuromycinGenome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. Cas9n (D10A nickase mutant) from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0) PX462
    lentiCas9n(D10A)-BlastCas9 (Synthetic), Blasticidin resistanceEFS-NS, EFS-NSBlasticidinImproved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. Expresses human codon-optimized S. pyogenes Cas9n (D10A nickase) protein and blasticidin resistance from EFS promoter. Lentiviral backbone. pFUGW
    PX429 SpCas9 N863A nickaseSpCas9 N863A nicking mutant (Synthetic)CbhCrystal structure of Cas9 in complex with guide RNA and target DNA. Cell. 2014 Feb 27;156(5):935-49. doi: 10.1016/j.cell.2014.02.001. Epub 2014 Feb 13. SpCas9 N863A nickase PX165
    pCR1054T7pr_6xHis-MBP-TEV-SPynCas9 (D10A)-2xNLSEnhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 2016 Jan 20. doi: 10.1038/nbt.3481. Express Streptococcus pyogenes nCas9 (D10A) nickase carrying two C-terminal SV40 NLS SPynCas9
    pCR1055T7pr_6xHis-MBP-TEV-SPynCas9 (H840A)-2xNLSEnhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 2016 Jan 20. doi: 10.1038/nbt.3481. Express Streptococcus pyogenes nCas9 (H840A) nickase carrying two C-terminal SV40 NLS SPynCas9
    AIO-GFPCRISPR-Cas9(D10A) nickase-based genotypic and phenotypic screening to enhance genome editing. Sci Rep. 2016 Apr 15;6:24356. doi: 10.1038/srep24356. All-in-One plasmid encoding dual U6 promoter-driven sgRNAs and EGFP-coupled Cas9-D10A nickase to enhance efficient and accurate genome editing All-in-One
    AIO-mCherryCRISPR-Cas9(D10A) nickase-based genotypic and phenotypic screening to enhance genome editing. Sci Rep. 2016 Apr 15;6:24356. doi: 10.1038/srep24356. All-in-One plasmid encoding dual U6 promoter-driven sgRNAs and mCherry-coupled Cas9-D10A nickase to enhance efficient and accurate genome editing All-in-One
    AIO-PuroCbhPuromycinCRISPR-Cas9(D10A) nickase-based genotypic and phenotypic screening to enhance genome editing. Sci Rep. 2016 Apr 15;6:24356. doi: 10.1038/srep24356. All-in-One plasmid encoding dual U6 promoter-driven sgRNAs and Cas9-D10A nickase linked via 2A peptide with puromycin resistant marker to enhance efficient and accurate genome editing All-in-One_Nickase-D10A
  • Tag / Fusion Protein
    • Puromycin resistant marker
  • Interfere

    A catalytically inactive Cas9 (dCas9) or dCas9-repressor peptide fusion can be used to knock-down gene expression by interfering with transcription of the gene. Design your gRNA sequence to direct the dCas9 repressor to a specific genomic sequence. Potential target locations can include promoter regions, regulatory regions, and early coding regions. If the plasmid that you choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target the dCas9 repressor.

    Plasmid Gene/Insert Promoter Selectable Marker PI Publication Hidden Extra Search Info
    pdCas9-humanizeddead Cas9 with 3X NLS (Homo sapiens)MSCV LTR promoterPuromycin Qi Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell. 2013 Feb 28;152(5):1173-83. doi: 10.1016/j.cell.2013.02.022. Expression of a catalytically inactive, human codon-optimized Cas9 under the control of Murine Stem Cell retroVirus LTR promoter for mammalian gene knockdown pMSCVpuro
    pdCas9::BFP-humanizeddCas9 fused to BFP (Homo sapiens)MSCV LTR promoterPuromycin Qi Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell. 2013 Feb 28;152(5):1173-83. doi: 10.1016/j.cell.2013.02.022. Expression of a catalytically inactive, human codon-optimized Cas9-BFP fusion under the control of Murine Stem Cell retroVirus LTR promoter for mammalian gene knockdown pMSCVpuro
    pHR-SFFV-dCas9-BFPdCas9-BFP fusion (Homo sapiens)SFFV Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Human expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS and tagBFP pHR
    pHR-SFFV-dCas9-BFP-KRABdCas9-BFP-KRAB fusion (Homo sapiens)SFFV Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Human expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS, tagBFP and a KRAB domain pHR
    pcDNA-dCas9dCas9 (Other)CMV Gersbach RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nat Methods. 2013 Jul 25. doi: 10.1038/nmeth.2600. Expresses inactivated S. pyogenes dCas9 (D10A, H840A) in mammalian cells pcDNA3.1
    Cas9m2Cas9m2 (Other) Church CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9 D10A+H840A pcDNA3.3_TOPO
    Cas9m3Cas9m3 (Other) Church CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9 D10A+D839A+H840A pcDNA3.3_TOPO
    Cas9m4Cas9m4 (Other) Church CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9 D10A+D839A+H840A+N863A pcDNA3.3_TOPO
    pAC84-pCR8-dCas9dCas9(D10A;H840A) (Homo sapiens) Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. dCas9 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expression pCR8/GW/TOPO
    pHAGE TRE dCas9dCas9 (Other)TRENeomycin (select with G418) Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Tet-regulatable dCas9 lentiviral expression vector pHAGE
    pHAGE TRE dCas9-KRABdCas9 (Other)TRENeomycin (select with G418) Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Tet-regulatable dCas9-KRAB lentiviral expression vector pHAGE
    pHAGE EF1α dCas9-KRABdCas9 (Other)EF1alphaPuromycin Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Constitutive dCas9-KRAB lentiviral expression vector pHAGE
    pSLQ1658-dCas9-EGFPdCas9 fuse to EGFP (Homo sapiens)MSCV LTR promoterPuromycin Qi Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. Template for NLS-dCas9-NLS-EGFP fusion protein for CRISPR imaging (the recipient vector can be TetON 3G promoter system) pMSCVpuro
    pLV hUbC-dCas9-T2A-GFPhumanized dead Cas9 T2A GFP (Other)hUbCZeocin Gersbach Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 2014 Aug 13. pii: gku749. Co-expresses human optimized S. pyogenes dCas9 and GFP FUGW
    pcDNA3.1-CibN-dCas9CibN-dCas9 (Arabidopsis thaliana)CMVNeomycin (select with G418) Gersbach A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753. Expresses CibN-dCas9 in mammalian cells pcDNA3.1
    pcDNA3.1-dCas9-CibNdCas9-CibN (Arabidopsis thaliana)CMVNeomycin (select with G418) Gersbach A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753. Expresses dCas9-CibN in mammalian cells pcDNA3.1
    pcDNA3.1-CibN-dCas9-CibNdCas9-CibN (Arabidopsis thaliana)CMVNeomycin (select with G418) Gersbach A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753. Expresses CibN-dCas9-CibN in mammalian cells pcDNA3.1
    pHR-SFFV-KRAB-dCas9-P2A-mCherryKRAB-dCas9-P2A-mCherry fusion (Homo sapiens)SFFVmCherry Weissman Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 2014 Oct 23;159(3):647-61. doi: 10.1016/j.cell.2014.09.029. Epub 2014 Oct 9. 2nd Generation Lentiviral vector. Expresses an N-terminal KRAB-dCas9 fusion protein and mCherry pHR
    pcDNA-dCas9-HAS.pyogenes dCas9 with c-terminal HA tag (Synthetic)CMV Gersbach Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol. 2015 May;33(5):510-7. doi: 10.1038/nbt.3199. Epub 2015 Apr 6. encodes c-terminal HA-tagged S. pyogenes dCas9 driven by CMV promoter pcDNA3.1
    pJZC77sgRNA, COM-KRABU6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cells MP177_U6 (derived from pSico)
    pJZC78sgRNA + 1x COM binding module, COM-KRABU6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1x COM with COM-KRAB effector for mammalian cells MP177_U6 (derived from pSico)
    pJZC73sgRNA, COM-KRABU6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cells MP177_U6 (derived from pSico)
    pJZC74sgRNA + 1x COM binding module, COM-KRABU6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1x COM with COM-KRAB effector for mammalian cells MP177_U6 (derived from pSico)
    pX330A_dCas9-1x2humanized S. pyogenes dCas9 (Other)CBh Yamamoto Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnol. 2015 May 22;15(1):33. Expresses dCas9 and gRNA pUC ori vector
    pX330A_dCas9-1x3humanized S. pyogenes dCas9 (Other)CBh Yamamoto Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnol. 2015 May 22;15(1):33. Expresses dCas9 and gRNA pUC ori vector
    pX330A_dCas9-1x5humanized S. pyogenes dCas9 (Other)CBh Yamamoto Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnol. 2015 May 22;15(1):33. Expresses dCas9 and gRNA pUC ori vector
    pX330A_dCas9-1x6humanized S. pyogenes dCas9 (Other)CBh Yamamoto Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnol. 2015 May 22;15(1):33. Expresses dCas9 and gRNA pUC ori vector
    pEF_dCas9dCas9 (Other)human EF1[alpha] Rinn Multiplexable, locus-specific targeting of long RNAs with CRISPR-Display. Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1. Transient expression of Sp-dCas9 in mammalian cells, under an EF1-alpha promoter. pNEB193
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)
  • pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Purohumanized dCas9-KRAB T2A Puro (Other), sgRNAPuromycin Gersbach Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nat Methods. 2015 Dec;12(12):1143-9. doi: 10.1038/nmeth.3630. Epub 2015 Oct 26. Express sgRNA and dCas9-KRAB from lentiviral vector FUGW
    pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFPhumanized dCas9-KRAB T2A GFP (Other), sgRNA Gersbach Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nat Methods. 2015 Dec;12(12):1143-9. doi: 10.1038/nmeth.3630. Epub 2015 Oct 26. Express sgRNA and dCas9-KRAB from lentiviral vector FUGW
    pCR1003T7pr_10xHis-MBP-TEV-SPydCas9 (D10A, H840A) Corn Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 2016 Jan 20. doi: 10.1038/nbt.3481. Express Streptococcus pyogenes dCas9 (D10A, H840A) SPynCas9
    pCR1056T7pr_6xHis-MBP-TEV-SPydCas9 (D10A,H840A)-2xNLS Corn Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 2016 Jan 20. doi: 10.1038/nbt.3481. Express Streptococcus pyogenes dCas9 (D10A, H840A) carrying two C-terminal SV40 NLS SPynCas9
    pAC1445-pmax-dCas9dCas9 (Synthetic)CAGGS + chim intron Cheng pAC1445 (unpublished) dCas9 expressed in pmax vector pAC90-pmax-DEST
    pAAVS1-NDi-CRISPRi (Gen1)dCas9-KRAB-P2A-mCherry (Synthetic), rtTA (Synthetic)TRE3G, CAGNeomycin (select with G418) Conklin CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10. Dox-inducible CRISPR interference (CRISPRi) knock in construct into the AAVS1 locus with mCherry marker pAAVS1
    pAAVS1-NDi-CRISPRi (Gen2)dCas9-KRAB (Synthetic), rtTA (Synthetic)TRE3G, CAGNeomycin (select with G418) Conklin CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10. Dox-inducible CRISPR interference (CRISPRi) knock in construct into the AAVS1 locus pAAVS1
    pAAVS1-NC-CRISPRi (Gen3)dCas9-KRAB (Synthetic)CAGNeomycin (select with G418) Conklin CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi: 10.1016/j.stem.2016.01.022. Epub 2016 Mar 10. Constitutive CRISPR interference (CRISPRi) knock in construct into the AAVS1 locus pAAVS1
    pHAGE-TO-dCas9Sp dCas9 (Synthetic)CMV-TO Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. dCas9 pHAGE-DEST
    CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-PurosgRNA and dCas9 from pX330 (Other)U6 for sgRNA and CBh for dCas9Puromycin Kimura Dr. Sekita CRISPR/Cas9 (unpublished) Lentivirus vector to express guideRNA and dCas9 with puro resistant gene CSII
    pLV-dCas9-KRAB-PGK-HygRhumanized dead Cas9 KRAB (Other), aminoglycoside phosphotransferase from E. coli (Other)Human Ubiquitin C Promoter, mouse phosphoglycerate kinase 1 promoterHygromycin Gersbach CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853. Lentiviral Sp dCas9-KRAB fusion with Hygromycin B resistance cassette. FUGW
    pSLQ2818 pPB: CAG-PYL1-KRAB-IRES-Puro-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9ABI-tagBFP-Sp dCas9 (Arabidopsis thaliana), PYL1-KRAB (Arabidopsis thaliana)PGK, CAGPuromycin Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses ABA-inducible KRAB-Sp dCas9 PB
    pSLQ2813 pPB: CAG-GID1-KRAB-IRES-Puro-WPRE PGK-ABI-tagBFP-SpdCas9GAI-tagBFP-Sp dCas9 (Arabidopsis thaliana), GID1-KRAB (Arabidopsis thaliana)PGK, CAGPuromycin Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses GA-inducible KRAB-Sp dCas9 PB
    pSLQ2815 pPB: CAG-Puro-WPRE PGK-KRAB-tagBFP-SpdCas9KRAB-tagBFP-Sp dCas9 (Synthetic), PuroPGK, CAGPuromycin Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses direct fusion KRAB-Sp dCas9 PB
    pGH125_dCas9-BlastdCas9 and Blasticidin resistanceBlasticidin Bassik Directed evolution using dCas9-targeted somatic hypermutation in mammalian cells. Nat Methods. 2016 Oct 31. doi: 10.1038/nmeth.4038. lentiviral expression vector for dCas9 with Blasticidin selectable marker Addgene #61425
    TRE-KRAB-dCas9-IRES-BFPKRAB-dCas9-IRES-BFP (Synthetic)TRE3GBFP Lander Systematic mapping of functional enhancer-promoter connections with CRISPR interference. Science. 2016 Sep 29. pii: aag2445. Lentiviral vector expressing a KRAB-dCas9 fusion protein and BFP pHR
    TRE-KRAB-dCas9-IRES-GFPKRAB-dCas9-IRES-GFP (Synthetic)TRE3GGFP Lander Systematic mapping of functional enhancer-promoter connections with CRISPR interference. Science. 2016 Sep 29. pii: aag2445. Lentiviral vector expressing a KRAB-dCas9 fusion protein and GFP pHR
    pMH0001dCas9 (Other)SFFVBFP fluorescence Weissman A Multiplexed Single-Cell CRISPR Screening Platform Enables Systematic Dissection of the Unfolded Protein Response. Cell. 2016 Dec 15;167(7):1867-1882.e21. doi: 10.1016/j.cell.2016.11.048. UCOE-SFFV-dCas9-BFP-KRAB pHR-SFFV-dCas9-BFP-KRAB
    Lenti-dCas9-KRAB-blastdCas9 (Synthetic)Blasticidin Hon Multiplexed Engineering and Analysis of Combinatorial Enhancer Activity in Single Cells. Mol Cell. 2017 Apr 20;66(2):285-299.e5. doi: 10.1016/j.molcel.2017.03.007. Epub 2017 Apr 13. Plasmid expression dCas9 protein in fusion with KRAB domain plenti
    pX330-Flag-dHeFSpCas9dead/inactive HeFSpCas9 with FLAG tag (Other)Cbh Welker Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. Expression plasmid for human codon-optimized dead/inactive increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence) pX330-like (without U6-sgRNA coding sequence)
    pLX_311-KRAB-dCas9dCas9 (Other)EF1aBlasticidin Hahn Complementary information derived from CRISPR Cas9 mediated gene deletion and suppression. Nat Commun. 2017 May 23;8:15403. doi: 10.1038/ncomms15403. for CRISPRi, lentiviral expression of KRAB-dCas9 and BlastR. Also called pXPR_121 pXPR
  • Tag / Fusion Protein
    • KRAB (N terminal on insert)
  • lenti-EF1a-dCas9-KRAB-PurodCas9-KRAB-T2A-Puro (Other)EF-1aPuromycin, Zeocin Brennand Evaluating Synthetic Activation and Repression of Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and Astrocytes. Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi: 10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27. 3rd generation lenti vector encoding dCas9-KRAB with 2A puromycin resistance marker (EF1a-dCas9-KRAB-T2A-Puro-WPRE) pLenti

    Activate

    A catalytically inactive Cas9 (dCas9) fused to a transcription activator peptide can increase transcription of a gene. Design your gRNA sequence to direct the dCas9-activator to a specific genomic sequence. Potential target locations can include promoter regions and regulatory regions. If the plasmid that you choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target the dCas9-activator.

    Plasmid Gene/Insert Promoter Selectable Marker PI Publication Hidden Extra Search Info
    pMSCV-LTR-dCas9-VP64-BFPdCas9-VP64-BFP fusion (Homo sapiens), Puromycin resistanceLTR, PGKPuromycin Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Human expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, VP64 and tagBFP MSCV-puro
    pMSCV-LTR-dCas9-p65AD-BFPdCas9-p65AD-BFP fusion (Homo sapiens), Puromycin resistanceLTR, PGKPuromycin Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Human expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, p65 activation domain and tagBFP MSCV-puro
    pcDNA-dCas9-VP64dCas9-VP64 (Other)CMV Gersbach RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nat Methods. 2013 Jul 25. doi: 10.1038/nmeth.2600. Expresses inactivated S. pyogenes dCas9 (D10A, H840A) fused to VP64 transactivator domain in mammalian cells pcDNA3.1
    Cas9m2-VP64Cas9m2-VP64 (Other) Church CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9m2 Activator pcDNA3.3_TOPO
    Cas9m3-VP64Cas9m3-VP64 (Other) Church CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9m3 Activator pcDNA3.3_TOPO
    Cas9m4-VP64Cas9m4-VP64 (Other) Church CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9m4 Activator pcDNA3.3_TOPO
    pSL690dCas9-VP64 (Synthetic)CMV Joung CRISPR RNA-guided activation of endogenous human genes. Nat Methods. 2013 Jul 25. doi: 10.1038/nmeth.2598. Expresses dCas9-VP64 fusion unknown
    pMLM3705codon optimized dCas9-VP64 (Synthetic)CMV Joung CRISPR RNA-guided activation of endogenous human genes. Nat Methods. 2013 Jul 25. doi: 10.1038/nmeth.2598. Expresses mammalian cell codon-optimized dCas9-VP64 pJDS246
    pAC1-pCR8-dCas9VP48dCas9(D10A;H840A) fusion with VP48 activation domain (Synthetic) Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. dCas9VP48 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expression pCR8/GW/TOPO
    pAC147-pCR8-dCas9VP64dCas9(D10A;H840A) fusion with VP64 activation domain (Homo sapiens) Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. dCas9VP64 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expression  pCR8/GW/TOPO
    pAC148-pCR8-dCas9VP96dCas9(D10A;H840A) fusion with VP96 activation domain (Homo sapiens) Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. dCas9VP96 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expression pCR8/GW/TOPO
    pAC149-pCR8-dCas9VP160dCas9(D10A;H840A) fusion with VP160 activation domain (Homo sapiens) Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. dCas9VP160 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expression pCR8/GW/TOPO
    pAC91-pmax-dCas9VP64dCas9(D10A;H840A) fusion with VP64 activation domain (Homo sapiens)CAGGS Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. dCas9VP64 on pmax expression vector pmax-DEST (Addgene: 48222)
    pAC92-pmax-dCas9VP96dCas9(D10A;H840A) fusion with VP96 activation domain (Homo sapiens)CAGGS Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. dCas9VP96 on pmax expression vector pmax-DEST (Addgene: 48222)
    pAC93-pmax-dCas9VP160dCas9(D10A;H840A) fusion with VP160 activation domain (Homo sapiens)CAGGS Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. dCas9VP160 on pmax expression vector pmax-DEST (Addgene: 48222)
    pAC94-pmax-dCas9VP160-2A-purodCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-puro (Homo sapiens)CAGGSPuromycin Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. dCas9VP160-2A-puro (puro-selectable) on pmax expression vecor. Note: This is being tested. pmax-DEST (Addgene: 48222)
    pAC95-pmax-dCas9VP160-2A-neodCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-neo (Homo sapiens)CAGGSNeomycin (select with G418) Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. dCas9VP160-2A-neo (neo/G418-selectable) on pmax expression vector. Note: This is being tested. pmax-DEST (Addgene: 48222)
    pAC2-dual-dCas9VP48-sgExpressiondCas9VP48 (Homo sapiens) Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. Dual expression construct expressing both dCas9VP48 and sgRNA from separate promoters pX335 (Addgene #42335)
    pAC5-dual-dCas9VP48-sgTetOdCas9VP48 and sgTetO (Synthetic) Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. Dual expression construct expressing both dCas9VP48 and sgTetO from separate promoters pAC2-dual-dCas9VP48-sgExpression (Addgene #48236)
    pAC152-dual-dCas9VP64-sgExpressiondCas9 (Synthetic) Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. Dual expression construct expressing both dCas9VP64 and sgRNA from separate promoters pX335 (Addgene #42335)
  • Tags / Fusion Proteins
    • HA-Tag (N terminal on insert)
    • VP64 (C terminal on insert)
  • pAC153-dual-dCas9VP96-sgExpressiondCas9 (Synthetic) Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. Dual expression construct expressing both dCas9VP96 and sgRNA from separate promoters pX335 (Addgene #42335)
  • Tags / Fusion Proteins
    • HA-Tag (N terminal on insert)
    • VP96 (C terminal on insert)
  • pAC154-dual-dCas9VP160-sgExpressiondCas9 (Synthetic) Jaenisch Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. Dual expression construct expressing both dCas9VP160 and sgRNA from separate promoters pX335 (Addgene #42335)
  • Tags / Fusion Proteins
    • HA-Tag (N terminal on insert)
    • VP160 (C terminal on insert)
  • M-SPn-VP64Cas9-VP64, nuclease-null (Other)CMVNeomycin (select with G418) Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian SP-VP64 nuclease-null Cas9 activator expression, human optimized pcDNA3.3 TOPO
    M-ST1n-VP64Cas9-VP64, nuclease-null (Other)CMVNeomycin (select with G418) Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian ST1-VP64 nuclease-null Cas9 activator expression, human optimized pcDNA3.3 TOPO
    M-NMn-VP64Cas9-VP64, nuclease-null (Other)CMVNeomycin (select with G418) Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian NM-VP64 nuclease-null Cas9 activator expression, human optimized pcDNA3.3 TOPO
    pCMV_dCas9_VP64dCas9_VP64 (human-codon-optimized) (Homo sapiens)CMV Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes human-optimized dCas9_VP64 synthetic transcription factor phi-Yellow-Dest
    pHAGE TRE dCas9-VP64dCas9 (Other)TRENeomycin (select with G418) Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Tet-regulatable dCas9-VP64 lentiviral expression vector pHAGE
    pHAGE EF1α dCas9-VP64dCas9 (Other)EF1alphaPuromycin Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. Constitutive dCas9-VP64 lentiviral expression vector pHAGE
    pLV hUbC-dCas9 VP64-T2A-GFPhumanized dead Cas9 VP64 T2A GFP (Other)hUbC Gersbach Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 2014 Aug 13. pii: gku749. Co-expresses human optimized S. pyogenes dCas9-VP64 and GFP FUGW
    CMVp-dCas9-3xNLS-VP64 (Construct 1)dCas9 (Homo sapiens)CMV/hUBC Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. Expresses taCas9 in Mammalian cells for transactivating endogenous and synthetic promoters. The backbone is a lentiviral vector. pFUGw (Addgene id: 25870)
    pLV hUbC-VP64 dCas9 VP64-T2A-GFPhumanized VP64 dead Cas9 VP64 T2A GFP (Other) Gersbach Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 2014 Aug 13. pii: gku749. Co-expresses human optimized S. pyogenes dCas9 fused to two copies of VP64 and GFP FUGW
    pcDNA3.1-CibN-dCas9CibN-dCas9 (Arabidopsis thaliana)CMVNeomycin (select with G418) Gersbach A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753. Expresses CibN-dCas9 in mammalian cells pcDNA3.1
    pcDNA3.1-dCas9-CibNdCas9-CibN (Arabidopsis thaliana)CMVNeomycin (select with G418) Gersbach A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753. Expresses dCas9-CibN in mammalian cells pcDNA3.1
    pcDNA3.1-CibN-dCas9-CibNdCas9-CibN (Arabidopsis thaliana)CMVNeomycin (select with G418) Gersbach A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753. Expresses CibN-dCas9-CibN in mammalian cells pcDNA3.1
    pHRdSV40-dCas9-10xGCN4_v4-P2A-BFPCas9 dead Vale A Protein-Tagging System for Signal Amplification in Gene Expression and Fluorescence Imaging. Cell. 2014 Oct 8. pii: S0092-8674(14)01227-6. doi: 10.1016/j.cell.2014.09.039. Expressed a nuclease dead Cas9 tagged with 10 copies of the GCN4 peptide v4 and BFP. This plasmid is part of the SunTag system for gene activation pHR
    pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLSscFv-GCN4 Vale A Protein-Tagging System for Signal Amplification in Gene Expression and Fluorescence Imaging. Cell. 2014 Oct 8. pii: S0092-8674(14)01227-6. doi: 10.1016/j.cell.2014.09.039. The plasmid encodes a antibody that binds to the GCN4 peptide from the SunTag system, and is fused to a transcriptional activation domain VP64 pHR
    pHRdSV40-NLS-dCas9-24xGCN4_v4-NLS-P2A-BFP-dWPREdCas9dSV40 Promoter Vale A Protein-Tagging System for Signal Amplification in Gene Expression and Fluorescence Imaging. Cell. 2014 Oct 8. pii: S0092-8674(14)01227-6. doi: 10.1016/j.cell.2014.09.039. dCas9 fused to 24 copies of the GCN4 peptide v4, which is part of the SunTag system pHR
    pcDNA-dCas9-FLp300S.pyogenes dCas9 with c-terminal full length human p300 (aa 2-2414) (Homo sapiens)CMV Gersbach Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol. 2015 May;33(5):510-7. doi: 10.1038/nbt.3199. Epub 2015 Apr 6. encodes S. pyogenes dCas9 with c-terminal fusion of FL human p300 (aa 2-2414) driven by CMV promoter pcDNA3.1 EP300 KAT3B, RSTS2, p300
    pcDNA-dCas9-p300 CoreS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (Homo sapiens)CMV Gersbach Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol. 2015 May;33(5):510-7. doi: 10.1038/nbt.3199. Epub 2015 Apr 6. encodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664) driven by CMV promoter pcDNA3.1 EP300 KAT3B, RSTS2, p300
    pcDNA-dCas9-p300 Core (D1399Y)S.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (Homo sapiens)CMV Gersbach Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol. 2015 May;33(5):510-7. doi: 10.1038/nbt.3199. Epub 2015 Apr 6. encodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation D1399Y) driven by CMV promoter pcDNA3.1 EP300 KAT3B, RSTS2, p300
    pcDNA-dCas9-p300 Core (1645/1646 RR/EE)S.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (Homo sapiens)CMV Gersbach Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol. 2015 May;33(5):510-7. doi: 10.1038/nbt.3199. Epub 2015 Apr 6. encodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation 1645/1646 RR/EE) driven by CMV promoter pcDNA3.1 EP300 KAT3B, RSTS2, p300
    pcDNA-dCas9-p300 Core (C1204R)S.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (Homo sapiens)CMV Gersbach Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol. 2015 May;33(5):510-7. doi: 10.1038/nbt.3199. Epub 2015 Apr 6. encodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation C1204R) driven by CMV promoter pcDNA3.1 EP300 KAT3B, RSTS2, p300
    pcDNA-dCas9-p300 Core (Y1467F)S.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (Homo sapiens)CMV Gersbach Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol. 2015 May;33(5):510-7. doi: 10.1038/nbt.3199. Epub 2015 Apr 6. encodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inavtivating mutation Y1467F) driven by CMV promoter pcDNA3.1 EP300 KAT3B, RSTS2, p300
    pcDNA-dCas9-p300 Core (1396/1397 SY/WW)S.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (Homo sapiens)CMV Gersbach Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol. 2015 May;33(5):510-7. doi: 10.1038/nbt.3199. Epub 2015 Apr 6. encodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation 1396/1397 SY/WW) driven by CMV promoter pcDNA3.1 EP300 KAT3B, RSTS2, p300
    pcDNA-dCas9-p300 Core (H1415A/E1423A/Y1424A/L1428S/Y1430A/H1434A)S.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (Homo sapiens)CMV Gersbach Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol. 2015 May;33(5):510-7. doi: 10.1038/nbt.3199. Epub 2015 Apr 6. encodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutations H1415A/E1423A/Y1424A/L1428S/Y1430A/H1434A) driven by CMV promoter pcDNA3.1 EP300 KAT3B, RSTS2, p300
    pcDNA3.3-Nm-dCas9-p300 CoreNm-dCas9-p300 Core (Homo sapiens)CMVNeomycin (select with G418) Gersbach Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol. 2015 May;33(5):510-7. doi: 10.1038/nbt.3199. Epub 2015 Apr 6. encodes N. meningiditis dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664) driven by CMV promoter pcDNA3.3 EP300 KAT3B, RSTS2, p300
    dCAS9-VP64_GFPdCAS9(D10A,H840A)-VP64_2A_GFP (Synthetic)EF1AGFP Zhang Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 2014 Dec 10. doi: 10.1038/nature14136. Expresses dCAS9-VP64 activator with 2A GFP lenti(AMP)
    lenti dCAS-VP64_BlastdCAS9(D10A, N863A)-VP64_2A_Blast (Synthetic)EF1ABlasticidin Zhang Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 3rd generation lenti vector encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE) plenti
    TetO-FUW-VdC9BVVP64dCas9BFPVP64 (Synthetic) Leong A CRISPR/Cas9-Based System for Reprogramming Cell Lineage Specification. Stem Cell Reports. 2014 Dec 9;3(6):940-7. doi: 10.1016/j.stemcr.2014.09.013. Epub 2014 Oct 23. Expresses RNA-Guided, Nuclease-Inactive VP64:dCas9-BFP:VP64—VdC9BV—Fusion Protein to Enable Transactivation of Endogenous Genes TetO-FUW
    pJZC32sgRNA, MCP-VP64U6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cells MP177_U6 (derived from pSico)
    pJZC25sgRNA + 1x MS2 binding module, MCP-VP64U6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1x MS2 with MCP-VP64 effector for mammalian cells MP177_U6 (derived from pSico)
    pJZC33sgRNA + 2x MS2 binding module, MCP-VP64U6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 2x MS2 with MCP-VP64 effector for mammalian cells MP177_U6 (derived from pSico)
    pJZC34sgRNA + 2x MS2(wt+f6) binding module, MCP-VP64U6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells MP177_U6 (derived from pSico)
    pJZC41sgRNA, PCP-VP64U6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cells MP177_U6 (derived from pSico)
    pJZC39sgRNA + 1x PP7, mCherryU6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1x PP7 with mCherry for mammalian cells MP177_U6 (derived from pSico)
    pJZC101sgRNA, COM-VP64U6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA (no RNA aptamer addition) with COM-VP64 effector for mammalian cells MP177_U6 (derived from pSico)
    pJZC48sgRNA + 1x COM binding module, COM-VP64U6, CMVMarked by mCherry Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1x COM with COM-VP64 effector for mammalian cells MP177_U6 (derived from pSico)
    pJZC116sgRNA + 2x MS2 (wt+f6) binding module, MCP-VP64U6, CMVMarked by BFP Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFP MP177_U6 (derived from pSico)
    PX855SpCas9 (aa 2-535)CBh Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. N-term SpCas9 piece of inducible transcriptional activator (dCas9(N)-FRB-2xNES) PX330
    PX856SpCas9 (aa536-1368)CBh Zhang A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. C-term SpCas9 piece of inducible transcriptional activator (dCas9(C)-FKBP-2xNLS-VP64) PX330
    SP-dCas9-VPRSP-dCas9-VPR (Homo sapiens)CMVNeomycin (select with G418) Church Highly efficient Cas9-mediated transcriptional programming. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. SP-dCas9 with VP64-p65-Rta (VPR) fused to it's C-terminus; mammalian vector pcDNA3.3 TOPO
    M_ST1n_VPRST1-dCas9-VPR (Homo sapiens)CMVNeomycin (select with G418) Church Highly efficient Cas9-mediated transcriptional programming. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. ST1-dCas9 with VP64-p65-Rta (VPR) fused to it's C-terminus; mammalian vector pcDNA3.3 TOPO
    PB-TRE-dCas9-VPRdCas9-VPR (Homo sapiens)TREHygromycin Church Highly efficient Cas9-mediated transcriptional programming. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. SP-dCas9-VPR with doxycycline-inducible expression PB-TRE
    NLS-dCas9-trCIB1dCas9-trCIB1 fusion (Synthetic)CMVNeomycin (select with G418) Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Expression of genomic anchor probe, containing dCas9 and CIB1 pcDNA3.1/V5-His A
    pJZC42sgRNA + 1XPP7, PCP-VP64 IRES mCherryU6, CMVmCherry fluorescence Lim Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherry pSico
    pJZC43sgRNA + 2XPP7, PCP-VP64 IRES mCherryU6, CMVmCherry fluorescence Lim Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 2XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherry pSico
    pEF_dCas9-VP64dCas9 (Other)human EF1[alpha] Rinn Multiplexable, locus-specific targeting of long RNAs with CRISPR-Display. Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1. Transient expression of Sp-dCas9 fused to the VP64 transcription activator, in mammalian cells, under an EF1-alpha promoter. pNEB193
  • Tags / Fusion Proteins
    • 3xFLAG (C terminal on insert)
    • VP64 (C terminal on insert)
  • AAV_NLS-dSaCas9-NLS-VPRdSaCas9-VPR (Synthetic)CMV Church Cas9 gRNA engineering for genome editing, activation and repression. Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580. AAV vector containing nuclease null SaCas9 fused to VPR pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA Plasmid #61592
    CAG-DDdCas9VP192-T2A-EGFP-ires-puroDD-dCas9VP192-T2A-EGFP (Other)CAGPuromycin Otonkoski Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation. Stem Cell Reports. 2015 Sep 8;5(3):448-59. doi: 10.1016/j.stemcr.2015.08.001. DHFR destabilised domain (DD) fused to dCas9VP192 (S.pyogenes) on CAG expression vector. DDdCas9VP192 protein is stabilised by Trimethoprim. PyCAG
    pCXLE-dCas9VP192-T2A-EGFP-shP53dCas9-dCas9VP192-GFP-shp53 (Other)CAG Otonkoski Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation. Stem Cell Reports. 2015 Sep 8;5(3):448-59. doi: 10.1016/j.stemcr.2015.08.001. Episomal plasmid encoding dCas9VP192 and p53 shRNA pCXLE
    pCXLE-dCas9VP192-T2A-EGFPdCas9-dCas9VP192-EGFP (Other)CAG Otonkoski Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation. Stem Cell Reports. 2015 Sep 8;5(3):448-59. doi: 10.1016/j.stemcr.2015.08.001. Episomal plasmid encoding dCas9VP192 pCXLE
    pHRm-NLS-dCas9-GFP11x7-NLS-P2A-BFP-NLSNLS-dCas9-GFP11x7-NLS-P2A-BFP-NLS (Synthetic) Huang Versatile protein tagging in cells with split fluorescent protein. Nat Commun. 2016 Mar 18;7:11046. doi: 10.1038/ncomms11046. Expresses NLS-dCas9-GFP11x7-NLS and BFP-NLS in mammalian cells pHRdSV40-NLS-dCas9-24xGCN4_v4-NLS-P2A-BFP-dWPRE (addgene #60910)
    pAC164-pmax-dCas9Master-VP64dCas9-VP64 (Synthetic)CAGGS + chim intron Cheng Casilio: a versatile CRISPR-Cas9-Pumilio hybrid for gene regulation and genomic labeling. Cell Res. 2016 Feb;26(2):254-7. doi: 10.1038/cr.2016.3. Epub 2016 Jan 15. dCas9-3xGGGGS-VP64 in pmax expression vector pAC90-pmax-DEST
    pAC1364-pmax-dCas9Master_mCBPHATdCas9-mCBPHAT (Synthetic)CAGGS + chim intron Cheng Casilio: a versatile CRISPR-Cas9-Pumilio hybrid for gene regulation and genomic labeling. Cell Res. 2016 Feb;26(2):254-7. doi: 10.1038/cr.2016.3. Epub 2016 Jan 15. dCas9Master_mCBPHAT in pmax expression vector pAC90-pmax-DEST
    pAC1410-pmax-dCas9Master_p65HSF1dCas9-p65HSF1 (Synthetic)CAGGS + chim intron Cheng Casilio: a versatile CRISPR-Cas9-Pumilio hybrid for gene regulation and genomic labeling. Cell Res. 2016 Feb;26(2):254-7. doi: 10.1038/cr.2016.3. Epub 2016 Jan 15. dCas9Master_p65HSF1 in pmax expression vector pAC90-pmax-DEST
    lentiSAMv2U6 and EF1ABlasticidin Zhang Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nat Protoc. 2017 Apr;12(4):828-863. doi: 10.1038/nprot.2017.016. Epub 2017 Mar 23. lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2, dCas9-VP64, and blast resistance marker. Contains BsmBI sites for insertion of spacer sequences. plenti
    pLV-dCas9-p300-P2A-PuroRS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (Homo sapiens), pac from Streptomyces alboniger (Other)EFSPuromycin Gersbach CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853. Lentiviral Sp dCas9-p300-P2A-PuroR lentiCRISPR v2 EP300 KAT3B, RSTS2, p300
    AAVS1-idCas9-vprdCas9-VPR (Other)TRE-tightPuromycin Na An inducible CRISPR-ON system for controllable gene activation in human pluripotent stem cells. Protein Cell. 2017 Jan 23. doi: 10.1007/s13238-016-0360-8. inducible CRISPR-ON system for controllable gene activation; this plasmid is used to insert dCas9-VPR casette in one allele of AAVS1 locus AAVS1 homologous recombineering donor plasmid
    lentiSAM v2 (Puro)U6 (sgRNA) and EF1a (dCas9-VP64)Puromycin Karpf Lenti CRISPR Activate (unpublished) Modified version of lentiSAM v2, a lenti sgRNA cloning backbone with MS2 loops at tetraloop/stemloop 2, dCas9-VP64, and puro resistance marker. Contains BsmBI sites for insertion of spacer sequences. lentiSAM v2
    pXPR_120dCas9 (Other)EF1aBlasticidin Root Najm et al. (unpublished) for CRISPRa, lentiviral expression of dCas9-VPR 2A BlastR pXPR
  • Tag / Fusion Protein
    • VPR (C terminal on insert)
  • lenti-EF1a-dCas9-VP64-PurodCas9-VP64-T2A-Puro (Synthetic)EF-1aPuromycin, Zeocin Brennand Evaluating Synthetic Activation and Repression of Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and Astrocytes. Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi: 10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27. 3rd generation lenti vector encoding dCas9-VP64 with 2A puromycin resistance marker (EF1a-dCas9-VP64-T2A-Puro-WPRE) pLenti
    lenti-EF1a-dCas9-VPR-Puro(Sp)dCas9-VPR-P2A-Puro (Homo sapiens)EF-1aPuromycin, Zeocin Brennand Evaluating Synthetic Activation and Repression of Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and Astrocytes. Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi: 10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27. 3rd generation lenti vector encoding dCas9 (S. pyogenes) fused with VP64-p65-Rta (VPR) and 2A puromycin resistance marker; EF1a-dCas9-VPR-P2A-Puro-WPRE) pLenti

    Purify

    A catalytically inactive Cas9 (dCas9) fused to an epitope tag(s) can be used to purify genomic DNA bound by the gRNA. Design your gRNA sequence to direct the dCas9 to a specific genomic sequence. If the plasmid that you choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target the dCas9.

    Plasmid Gene/Insert Promoter Selectable Marker PI Publication Hidden Extra Search Info
    3xFLAG-dCas9/pCMV-7.13xFLAG-dCas9CMV Fujii Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Biochem Biophys Res Commun. 2013 Aug 11. pii: S0006-291X(13)01329-6. doi: 10.1016/j.bbrc.2013.08.013. Expresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest. pCMV-7.1
    3xFLAG-dCas9/pMXs-puro3xFLAG-dCas9 (Synthetic)LTRPuromycin Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. Expresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest. pMXs-puro
    3xFLAG-dCas9/pMXs-IG3xFLAG-dCas9 (Synthetic)LTRenhanced GFP Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. Expresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest. pMXs-IG
    3xFLAG-dCas9/pMXs-I23xFLAG-dCas9 (Synthetic)LTRhuman CD2 Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. Expresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest. pMXs-I2
    3xFLAG-dCas9/pMXs-neo3xFLAG-dCas9 (Synthetic)LTRNeomycin (select with G418) Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. Expresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest. pMXs-neo
    3xFLAG-dCas9/MSCV-EGFP3xFLAG-dCas9 (Synthetic)LTREGFP Fujii Fujii lab 3xFLAG-dCas9 plasmids (unpublished) Expresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest. MSCV-EGFP
    CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-PurosgRNA and dCas9 from pX330 (Other)U6 for sgRNA and CBh for dCas9Puromycin Kimura Dr. Sekita CRISPR/Cas9 (unpublished) Lentivirus vector to express guideRNA and dCas9 with puro resistant gene CSII
    pLenti_dCas9-2xAMSp-dCas9-2xAM tag (Synthetic), gRNA to be inserted into Bbs I sites (Synthetic)CBh, U6Puromycin Fujii Fujii lab enChIP lentiviral plasmids with 2xAM tag (unpublished) Lentiviral plasmid expressing dCas9-2xAM and gRNA cloned in Bbs I sites CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
    pLenti_dCas9-2xAM_hIRF-1Sp-dCas9-2xAM tag (Synthetic), gRNA targeting human IRF-1 promoter (Synthetic)CBh, U6Puromycin Fujii Fujii lab enChIP lentiviral plasmids with 2xAM tag (unpublished) Lentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoter CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
    pEF1a-FB-dCas9-puroN-terminal Flag and biotin-acceptor-site (FB)-tagged dCas9 (Other), puromycin (Other)Human EF1aPuromycin Xu In Situ Capture of Chromatin Interactions by Biotinylated dCas9. Cell. 2017 Aug 24;170(5):1028-1043.e19. doi: 10.1016/j.cell.2017.08.003. Expresses N-terminal Flag and biotin-acceptor-site (FB)-tagged dCas9 protein pEF1a-FB-puro

    Visualize

    A catalytically inactive Cas9 (dCas9) fused to a fluorescent protein (FP) can be used to visualize specific genomic loci using fluorescent microscopy in living cells. Design your gRNA sequence to direct the dCas9-FP fusion to a specific genomic sequence. Potential target locations can include unique or repetitive regions. If the plasmid that you choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target the dCas9-FP protein.

    Plasmid Gene/Insert Promoter Selectable Marker PI Publication Hidden Extra Search Info
    pHR-SFFV-dCas9-BFPdCas9-BFP fusion (Homo sapiens)SFFV Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Human expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS and tagBFP pHR
    pSLQ1658-dCas9-EGFPdCas9 fuse to EGFP (Homo sapiens)MSCV LTR promoterPuromycin Qi Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. Template for NLS-dCas9-NLS-EGFP fusion protein for CRISPR imaging (the recipient vector can be TetON 3G promoter system) pMSCVpuro
    pBSKΔB-TRE-dCas9-EGFPdCas9-EGFP (Synthetic)TRE Ochiai Simultaneous live imaging of the transcription and nuclear position of specific genes. Nucleic Acids Res. 2015 Jun 19. pii: gkv624. Plasmid for tet-inducible expression of dCas9-EGFP in mammalian cells pBlueScript II SK (+)
    pHAGE-EFS-dCas9-GFPSp dCas9 (Synthetic)EFS Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Expression of Sp dCas9-GFP in mammalian cells pHAGE-DEST
    pHAGE-SSFV-dCas9-GFPSp dCas9 (Synthetic)SSFV Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Expression of Sp dCas9-GFP in mammalian cells pHAGE-DEST
    pHAGE-TO-dCas9-GFPSp dCas9 (Synthetic)CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Expression of Sp dCas9-GFP in mammalian cells pHAGE-DEST
    pHAGE-TO-dCas9-3XGFPSp dCas9 (Synthetic)CMV-TOGFP Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Expression of Sp dCas9-3XGFP in mammalian cells pHAGE-DEST
    pHAGE-TO-dCas9-3XmCherrySp dCas9 (Synthetic)CMV-TOmCherry Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Expression of Sp dCas9-3XmCherry in mammalian cells pHAGE-DEST
    pHAGE-TO-nmdCas9-3XGFPNm dCas9 (Synthetic)CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Expression of Nm dCas9-3XGFP in mammalian cells pHAGE-DEST
    pHAGE-TO-nmdCas9-3XmCherryNm dCas9 (Synthetic)CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Expression of Nm dCas9-3XmCherry in mammalian cells pHAGE-DEST
    pHAGE-TO-nls-st1dCas9-3nls-3XGFPSt1 dCas9 (Synthetic)CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Expression of St1 dCas9-3XGFP in mammalian cells pHAGE-DEST
    pHAGE-TO-nls-st1dCas9-3nls-3XGFP-nlsSt1 dCas9 (Synthetic)CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Expression of St1 dCas9-3XGFP in mammalian cells pHAGE-DEST
    pHAGE-TO-nls-st1dCas9-3nls-3XGFP-2nlsSt1 dCas9 (Synthetic)CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Expression of St1 dCas9-3XGFP in mammalian cells pHAGE-DEST
    pHAGE-TO-nls-st1dCas9-3nls-3XTagBFP2St1 dCas9 (Synthetic)CMV-TO Pederson Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. Expression of St1 dCas9-3XTagBFP2 in mammalian cells pHAGE-DEST
    pCDNA3.1- dCas9-2xNLS-EGFPdCas9-2xNLS-EGFPCMV Yeo Programmable RNA Tracking in Live Cells with CRISPR/Cas9. Cell. 2016 Mar 16. pii: S0092-8674(16)30204-5. doi: 10.1016/j.cell.2016.02.054. Expresses dCas9-2xNLS-EGFP in mammalian cells pCDNA3.1(-)
    pHAGE-TO-MCP-3XBFPnlsMCP (Synthetic)CMV-TO Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. MCP-3XBFPnls pHAGE-DEST
    pHAGE-EFS-MCP-3XBFPnlsMCP (Synthetic)EFS Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. MCP-3XBFPnls pHAGE-DEST
    pHAGE-EFS-PCP-3XGFPnlsPCP (Synthetic)EFS Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. PCP-3XGFPnls pHAGE-DEST
    pHAGE-EFS-N22p-3XRFPnlsN22p (Synthetic)EFS Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. N22p-3XRFPnls pHAGE-DEST
    pLH-sgRNA1-2XMS2sgRNA1-2XMS2 (Synthetic)U6Hygromycin Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-2XMS2 pLKO.1
    pLH-sgRNA1-2XPP7sgRNA1-2XPP7 (Synthetic)U6Hygromycin Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-2XPP7 pLKO.1
    pLH-sgRNA1-2XboxBsgRNA1-2XboxB (Synthetic)U6Hygromycin Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-2XboxB pLKO.1
    pLH-sgRNA1-MS2-PP7sgRNA1-2XMS2-PP7 (Synthetic)U6Hygromycin Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-MS2-PP7 pLKO.1
    pLH-sgRNA1-PP7-boxBsgRNA1-2XPP7-boxB (Synthetic)U6 Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-PP7-boxB pLKO.1
    pLH-sgRNA1-boxB-MS2sgRNA1-boxB-MS2 (Synthetic)U6Hygromycin Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-boxB-MS2 pLKO.1
    pLH-sgRNA1-boxB-MS2-PP7sgRNA1-boxB-MS2-PP7 (Synthetic)U6Hygromycin Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-boxB-MS2-PP7 pLKO.1

    Empty gRNA Expression Vectors

    You can use the tables on Addgene's Empty gRNA Vectors page to search based on factors such as selectable marker or cloning method. To isolate vectors to use in a mammalian experimental system, simply type "Mammalian" into the search bar. When using the CRISPR/Cas system, you will need to express both a Cas9 protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas9 act as an all-in-one vector, but their function (cut, nick, activate, interfere...) is limited to that of the Cas9 present on the plasmid. gRNA plasmids that do not co-express Cas9 require a separate plasmid that does so; however, these independent gRNA plasmids can be paired with a wide variety of Cas9 plasmids and therefore are not limited to a single Cas9 function.

    Addgene Blugene icon

    Do you have suggestions for other plasmids that should be added to this list?

    Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource!