|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Jon Ashwell > Conze et al > pgex6p-1mciap1
Plasmid 11465: pgex6p-1mciap1
Gene/insert name: mciap1
Insert size (bp): 1700
Gene/insert aliases: Birc2, Api1, Api2, IAP1, IAP2, MIHB, MIHC, Birc3, HIAP1, HIAP2, MIAP1, MIAP2, RNF48, cIAP1, cIAP2, mcIAP1, AW146227
Species of gene(s): M. musculus (mouse)
Fusion proteins or tags: GST
Terminal: N terminal on backbone
Vector backbone: pGEX6p-1
(Search Vector Database)
Backbone manufacturer: amersham
Type of vector: Bacterial expression
Backbone size (bp): 6600
Cloning site 5': EcoRI
Site destroyed during cloning: No
Cloning site 3': EcoRI
Site destroyed during cloning: No
5' Sequencing primer: GGGCTGGCAAGCCACGTTTGGTGG  (List of Sequencing Primers)
3' Sequencing primer: TCCGGGAGCTGCATGTGTCAGAGG
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Sequence:View sequence
Plasmid Provided In:DH5a
Principal Investigator:Jon Ashwell
Terms and Licenses:MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Article: Posttranscriptional downregulation of c-IAP2 by the ubiquitin protein ligase c-IAP1 in vivo. Conze DB et al. (Mol Cell Biol. 2005 Apr . 25(8):3348-56. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 11465" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved
Plasmid Cart
Your cart is empty.