|
Home
|
|
Deposit Plasmids
|
|
Request Plasmids
|
|
Plasmid Tools
|
|
About Addgene
|
 |
 |
 |
Browse > Jon Ashwell > Conze et al > pgex6p-1mciap1 Price: $65.00 Plasmid Links Related Plasmids Other Links Plasmid 11465: pgex6p-1mciap1
| Gene/insert name: | | mciap1 | |
| Insert size (bp): | | 1700 | |
| Gene/insert aliases: | | Birc2, Api1, Api2, IAP1, IAP2, MIHB, MIHC, Birc3, HIAP1, HIAP2, MIAP1, MIAP2, RNF48, cIAP1, cIAP2, mcIAP1, AW146227 | |
| Species of gene(s): | | M. musculus (mouse)
| |
| Fusion proteins or tags: | | GST | |
| Terminal: | | N terminal on backbone | |
| Vector backbone: | | pGEX6p-1 (Search Vector Database) | |
| Backbone manufacturer: | | amersham | |
| Type of vector: | | Bacterial expression | |
| Backbone size (bp): | | 6600 | |
| Cloning site 5': | | EcoRI | |
| Site destroyed during cloning: | | No | |
| Cloning site 3': | | EcoRI | |
| Site destroyed during cloning: | | No | |
| 5' Sequencing primer: | | GGGCTGGCAAGCCACGTTTGGTGG (List of Sequencing Primers) | |
| 3' Sequencing primer: | | TCCGGGAGCTGCATGTGTCAGAGG | |
| Bacteria resistance: | | Ampicillin | |
| High or low copy: | | High Copy | |
| Grow in standard E. coli @ 37C: | | Yes | |
| Sequence: | | View sequence | | Plasmid Provided In: | | DH5a | | Principal Investigator: | | Jon Ashwell | | Terms and Licenses: | | MTA | Click on map to enlarge
|
|