Addgene - pgex6p-1mciap1 Plasmid Data

Browse > Jon Ashwell > Conze et al > pgex6p-1mciap1

Price: $65.00

Plasmid Links

Related Plasmids

Jon Ashwell Lab Plasmids

Other Links

NCBI: Birc2

Birc2 antibodies

Print Friendly Email

Plasmid 11465: pgex6p-1mciap1

Gene/insert name:		mciap1
Insert size (bp):		1700
Gene/insert aliases:		Birc2, Api1, Api2, IAP1, IAP2, MIHB, MIHC, Birc3, HIAP1, HIAP2, MIAP1, MIAP2, RNF48, cIAP1, cIAP2, mcIAP1, AW146227
Species of gene(s):		M. musculus (mouse)
Fusion proteins or tags:		GST
Terminal:		N terminal on backbone
Vector backbone:		pGEX6p-1 (Search Vector Database)
Backbone manufacturer:		amersham
Type of vector:		Bacterial expression
Backbone size (bp):		6600
Cloning site 5':		EcoRI
Site destroyed during cloning:		No
Cloning site 3':		EcoRI
Site destroyed during cloning:		No
5' Sequencing primer:		GGGCTGGCAAGCCACGTTTGGTGG (List of Sequencing Primers)
3' Sequencing primer:		TCCGGGAGCTGCATGTGTCAGAGG
Bacteria resistance:		Ampicillin
High or low copy:		High Copy
Grow in standard E. coli @ 37C:		Yes
Sequence:		View sequence
Plasmid Provided In:		DH5a
Principal Investigator:		Jon Ashwell
Terms and Licenses:		MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Article: Posttranscriptional downregulation of c-IAP2 by the ubiquitin protein ligase c-IAP1 in vivo. Conze DB et al. (Mol Cell Biol. 2005 Apr . 25(8):3348-56. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 11465" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.