Addgene - pLIC.B3.AF2373 Plasmid Data

Browse > Sung-Hou Kim > Liu et al > pLIC.B3.AF2373

Price: $65.00

Plasmid Links

Reviews (0)

Related Plasmids

From this article

AF2373 plasmids

Sung-Hou Kim Lab Plasmids

Other Links

Print Friendly Email

Plasmid 11529: pLIC.B3.AF2373

Gene/insert name:		NAD kinase
Insert size (bp):		747
GenBank/Entrez ID of insert:		AAB91287 NP_071196 AF2373
Gene/insert aliases:		AF2373
Species of gene(s):		A. fulgidus
Fusion proteins or tags:		HisTag, TEV cleavable
Terminal:		N terminal on backbone
Vector backbone:		pLIC.B3 (Search Vector Database)
Type of vector:		Bacterial expression
Backbone size (bp):		6194
Cloning site 5':		SmaI
Site destroyed during cloning:		Yes
Cloning site 3':		SmaI
Site destroyed during cloning:		Yes
5' Sequencing primer:		TAATACGACTCACTATAGGG (List of Sequencing Primers)
3' Sequencing primer:		GTTGCATCACCTTCACCCTCTCC
Bacteria resistance:		Ampicillin
High or low copy:		High Copy
Grow in standard E. coli @ 37C:		Yes
Plasmid Provided In:		DH5a
Principal Investigator:		Sung-Hou Kim
Terms and Licenses:		MTA

Comments: Please note that the plasmid pLIC.B3.AF2373 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

This plasmid has not been sequence verified. If you would like Addgene to sequence a portion of this plasmid before you request it, please contact us.

Click on map to enlarge

Article: Crystal structures of an NAD kinase from Archaeoglobus fulgidus in complex with ATP, NAD, or NADP. Liu J et al. (J Mol Biol. 2005 Nov 25. 354(2):289-303. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 11529" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.