|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Patrick Aebischer > Szulc et al > pLVUTHshGATA1-tTR-KRAB
Plasmid 11650: pLVUTHshGATA1-tTR-KRAB
Gene/insert name: hUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on
Alternative names: shRNA against GATA1
GATCCCCGAAGCGCCTGATTGTCA GTTTCAAGAGAACTGACAATCAGGC GCTTCTTTTTGGAAA
GATA1
Insert size (bp): Unknown
Gene/insert aliases: GATA1, GF1, GF-1, NFE1, XLTT, ERYF1, GATA-1
Species of gene(s): H. sapiens (human)
Vector backbone: pLVUT-tTR-KRAB
(Search Vector Database)
Type of vector: Mammalian expression,Lentiviral,RNAi,Cre/Lox
Backbone size (bp): 11876
5' Sequencing primer: See map  (List of Sequencing Primers)
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: Use Stbl3 or HB101 to reduce chance of recombination. Grow at 37C
Sequence:View sequence
Author's Map:View map
Plasmid Provided In:Stbl3
Principal Investigator:Patrick Aebischer
Terms and Licenses:MTA, Tet Systems LULL

Comments: Transgenes can be expressed from any RNA Pol II promoter as part of bicistronic unit comprising the KRAB-based repressor; tetO sequences are inserted into the vector LTR. Tet-on and Tet-off versions rely on repressors that bind in the absence or the presence of doxycycline, respectively. Addition of Pol III promoter-small hairpin RNA cassette allows for drug-controllable RNA interference (Tet-on shRNA).

Please visit Trono lab website (http://tronolab.epfl.ch) to see frequently asked questions on cloning strategies and packaging. You may also visit LentiWeb (http://www.lentiweb.com) for discussion on cloning strategies and protocols.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
CAG_enhancer 318 - 605
CMV_immearly_promoter 239 - 815
CMV_fwd_primer 772 - 792
HIV-1_5_LTR 835 - 1015
truncHIV-1_3_LTR 835 - 1015
HIV-1_psi_pack 1126 - 1170
RRE 1680 - 1913
ORF frame 1 1558 - 2445
cPPT 2444 - 2459
hUbC_promoter 2617 - 3833
EGFP_N_primer 3926 - 3905
EGFP 3860 - 4576
ORF frame 2 3860 - 4579
EGFP_C_primer 4513 - 4534
IRES 4624 - 5127
TetR 5205 - 5804
ORF frame 3 5190 - 6197
WPRE 6270 - 6857
ORF frame 1 6358 - 7002
pBluescriptKS_primer 6876 - 6860
cPPT 6930 - 6945
U3PPT 6930 - 6951
TRE 7012 - 7299
H1_primer 7460 - 7479
loxP 7630 - 7663
HIV-1_5_LTR 7683 - 7863
truncHIV-1_3_LTR 7683 - 7863
BGH_rev_primer 7904 - 7887
bGH_PA_terminator 7890 - 8117
f1_origin 8180 - 8486
pBABE_3_primer 8620 - 8600
SV40_enhancer 8821 - 8606
SV40_promoter 8618 - 8886
SV40_origin 8785 - 8862
SV40pro_F_primer 8847 - 8866
EM7_promoter 8980 - 9047
bleo 9048 - 9419
sh_ble 9048 - 9422
SV40_PA_terminator 9555 - 9674
EBV_rev_primer 9643 - 9662
M13_reverse_primer 9736 - 9718
M13_pUC_rev_primer 9757 - 9735
lac_promoter 9800 - 9771
pBR322_origin 10728 - 10109
ORF frame 2 11743 - 10883
Ampicillin 11743 - 10883
AmpR_promoter 11813 - 11785
Unique restriction sites

AgeI 3847
EcoRV 6252
MscI 9051
FspI 11178

Article: A versatile tool for conditional gene expression and knockdown. Szulc J et al. (Nat Methods. 2006 Feb . 3(2):109-16. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 11650" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2010 Addgene, Inc. All Rights Reserved