Addgene - C-Ag20(8) Plasmid Data

Browse > Martin Smith > Hoover et al > C-Ag20(8)

Price: $65.00

Plasmid Links

Related Plasmids

Martin Smith Lab Plasmids

Other Links

NM_021604

NCBI: Agrn

Agrn antibodies

Print Friendly Email

Plasmid 11867: C-Ag20(8)

Gene/insert name:		Agrn
Alternative names:		Agrin
Insert size (bp):		552
GenBank/Entrez ID of insert:		NM_021604
Gene/insert aliases:		Agrn, Agrin
Species of gene(s):		M. musculus (mouse)
Fusion proteins or tags:		myc
Terminal:		C terminal on backbone
Fusion proteins or tags:		His
Terminal:		C terminal on backbone
Vector backbone:		pTrcHis2 (Search Vector Database)
Backbone manufacturer:		Invitrogen
Type of vector:		Bacterial expression
Backbone size (bp):		4406
Cloning site 5':		BamHI
Site destroyed during cloning:		No
Cloning site 3':		EcoRI
Site destroyed during cloning:		No
5' Sequencing primer:		AGAGGTATATATTAATGTATCG (List of Sequencing Primers)
3' Sequencing primer:		N/A
Bacteria resistance:		Ampicillin
High or low copy:		High Copy
Grow in standard E. coli @ 37C:		Yes
Sequence:		View sequence
Principal Investigator:		Martin Smith
Terms and Licenses:		MTA

Comments: Hilgenberg, L. G., Su, H., Gu, H., O'Dowd D, K. & Smith, M. A. (2006) alpha3Na+/K+-ATPase Is a neuronal receptor for agrin. Cell 125, 359-69.

The insert one sees when BLASTing the Addgene sequence is a region of alternative splicing that encodes 8 amino acids (ELTNEIPA) that distinguish C-Ag20(8) from C-Ag20(0)

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Article: The COOH-terminal domain of agrin signals via a synaptic receptor in central nervous system neurons. Hoover CL et al. (J Cell Biol. 2003 Jun 9. 161(5):923-32. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 11867" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.