|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Martin Smith > Hoover et al > C-Ag15
Plasmid 11868: C-Ag15
Gene/insert name: Agrn
Alternative names: Agrin
Insert size (bp): 417
GenBank/Entrez ID of insert: NM_021604
Gene/insert aliases: Agrn, Agrin
Species of gene(s): M. musculus (mouse)
Fusion proteins or tags: myc
Terminal: C terminal on backbone
Fusion proteins or tags: His
Terminal: C terminal on backbone
Vector backbone: pTrcHis2
(Search Vector Database)
Backbone manufacturer: Invitrogen
Type of vector: Bacterial expression
Backbone size (bp): 4406
Cloning site 5': BamHI
Site destroyed during cloning: No
Cloning site 3': EcoRI
Site destroyed during cloning: No
5' Sequencing primer: AGAGGTATATATTAATGTATCG  (List of Sequencing Primers)
3' Sequencing primer: N/A
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Sequence:View sequence
Principal Investigator:Martin Smith
Terms and Licenses:MTA

Comments: Hilgenberg, L. G., Su, H., Gu, H., O'Dowd D, K. & Smith, M. A. (2006) alpha3Na+/K+-ATPase Is a neuronal receptor for agrin. Cell 125, 359-69.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Article: The COOH-terminal domain of agrin signals via a synaptic receptor in central nervous system neurons. Hoover CL et al. (J Cell Biol. 2003 Jun 9. 161(5):923-32. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 11868" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved