Addgene - pWZL Hygro-N FLAG Plasmid Data

Browse > Titia de Lange > Article > pWZL Hygro-N FLAG

Price: $65.00

Plasmid Links

Related Plasmids

Titia de Lange Lab Plasmids

Print Friendly Email

Plasmid 12541: pWZL Hygro-N FLAG

Gene/insert name:		N FLAG
Alternative names:		2410
Insert size (bp):		35
Vector backbone:		pWZL (Search Vector Database)
Type of vector:		Mammalian expression,Retroviral
Backbone size (bp):		5900
Cloning site 5':		BamHI
Site destroyed during cloning:		Yes
Cloning site 3':		BamHI
Site destroyed during cloning:		No
5' Sequencing primer:		CCTTTGTACACCCTAAGCCT (List of Sequencing Primers)
3' Sequencing primer:		AATGCTCGTCAAGAAGAC
Bacteria resistance:		Ampicillin
High or low copy:		High Copy
Grow in standard E. coli @ 37C:		Yes
Selectable markers:		Hygromycin
Sequence:		View sequence
Author's Map:		View map
Plasmid Provided In:		DH5a
Principal Investigator:		Titia de Lange
Terms and Licenses:		MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Please acknowledge the principal investigator if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 12541" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.