Addgene - pH3U3-mcs Plasmid Data

Gene/insert name:		Multiple cloning site in His3 Ura3 reporter plasmid
Insert size (bp):		44
GenBank/Entrez ID of insert:		DQ515893
Species of gene(s):		S. cerevisiae (budding yeast)
Vector backbone:		pH3U3 (Search Vector Database)
Type of vector:		Bacterial expression
Backbone size (bp):		5790
Cloning site 5':		NotI
Site destroyed during cloning:		No
Cloning site 3':		EcoRI
Site destroyed during cloning:		No
5' Sequencing primer:		CAAATATGTATCCGCTCATGAC (List of Sequencing Primers)
Bacteria resistance:		Kanamycin
High or low copy:		Low Copy
Grow in standard E. coli @ 37C:		Yes
Selectable markers:		URA3,HIS3
Sequence:		View sequence
Author's Map:		View map
Plasmid Provided In:		DH5a
Principal Investigator:		Scot Wolfe
Terms and Licenses:		MTA

Comments: Please note that the cloning information for this plasmid has been corrected as of 1/14/09. The 5' cloning site was changed from MluI to NotI.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features

rrnB_T1_terminator

15 - 58

ORF frame 3

1583 - 633

NeoR/KanR

3252 - 2473

ORF frame 1

3264 - 2470

NEOKAN_promoter

3400 - 3353

rrnB_T1_terminator

3422 - 3465

rrnB_T2_terminator

3597 - 3624

lac_promoter

3785 - 3814

M13_pUC_rev_primer

3825 - 3847

HIS3

3856 - 4515

ORF frame 1

3856 - 4518

URA3

4566 - 5366

ORF frame 3

4566 - 5369

f1_origin

5816 - 5510

Unique restriction sites

XbaI		1
SpeI		1650
AflII		1941
SacI		2449
FspI		3033
AatII		3405
AgeI		3407
SmaI		3748
NotI		3752
ApaLI		3759
EcoRI		3779
SalI		3817
NheI		4363
KpnI		4481
BamHI		4544
ApaI		4944
StuI		5002
XhoI		5370

Article: A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Meng X et al. (Nat Biotechnol. 2005 Aug . 23(8):988-94. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 12609" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.