|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Lucy M. Anderson > Shiao et al > pEGFP-N1-wtVHL
Price: $65.00
 

 

This is commonly
requested with
pEGFP-C1-wtVHL
Plasmid 13389: pEGFP-N1-wtVHL
Gene/insert name: von Hippel-Lindau
Alternative names: VHL
Insert size (bp): 572
GenBank/Entrez ID of insert: NM_052801
Gene/insert aliases: Vhl, Vhlh
Species of gene(s): R. norvegicus (rat)
Vector backbone: PEGFP-N1
(Search Vector Database)
Backbone manufacturer: Clontech
Type of vector: Mammalian expression
Backbone size (bp): 4695
Cloning site 5': HindIII
Site destroyed during cloning: No
Cloning site 3': BamHI
Site destroyed during cloning: No
5' Sequencing primer: cggactcagatctcgagctcaa  (List of Sequencing Primers)
3' Sequencing primer: cgctgaacttgtggccgttt
Bacteria resistance: Kanamycin
High or low copy: Unknown
Grow in standard E. coli @ 37C: Yes
Selectable markers: Gentamicin
If you did not originally clone this gene, from whom and where did you receive the plasmid used to derive this plasmid: Michael Lerman, NCI-Frederick
Sequence:View sequence
Plasmid Provided In:DH5a
Principal Investigator:Lucy M. Anderson
Terms and Licenses:MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
CAG_enhancer 65 - 352
CMV_immearly_promoter 10 - 562
CMV_fwd_primer 519 - 539
CMV_promoter 520 - 589
EGFP_N_primer 1279 - 1258
EGFP 1213 - 1929
ORF frame 1 1213 - 1932
EGFP_C_primer 1866 - 1887
EBV_rev_primer 2146 - 2165
f1_origin 2621 - 2315
AmpR_promoter 2700 - 2728
pBABE_3_primer 2814 - 2794
SV40_enhancer 3015 - 2800
SV40_promoter 2812 - 3080
SV40_origin 2979 - 3056
SV40pro_F_primer 3041 - 3060
ORF frame 1 3163 - 3957
NeoR/KanR 3166 - 3954
TK_PA_terminator 4132 - 4401
pBR322_origin 4549 - 5168
Unique restriction sites

AseI 7
NdeI 234
NheI 591
BglII 609
SacI 620
HindIII 622
SacII 711
BamHI 1194
AgeI 1200
XbaI 1945
AflII 2173
StuI 3112
ClaI 3131
NarI 3291
MscI 3373
FspI 3393
BstBI 3973
ApaLI 4895

Article: The von Hippel-Lindau tumor suppressor targets to mitochondria. Shiao YH et al. (Cancer Res. 2000 Jun 1. 60(11):2816-9. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 13389" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved