|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Lucy M. Anderson > Shiao et al > pEGFP-C1-wtVHL
Price: $65.00
 

 

This is commonly
requested with
pEGFP-N1-wtVHL
Plasmid 13390: pEGFP-C1-wtVHL
Gene/insert name: von Hippel-Lindau
Alternative names: VHL
Insert size (bp): 572
GenBank/Entrez ID of insert: NM_052801
Gene/insert aliases: Vhl, Vhlh
Species of gene(s): R. norvegicus (rat)
Fusion proteins or tags: GFP
Terminal: N terminal on backbone
Vector backbone: pEGFP-C1
(Search Vector Database)
Backbone manufacturer: Clontech
Type of vector: Mammalian expression
Backbone size (bp): 4693
Cloning site 5': HindIII
Site destroyed during cloning: No
Cloning site 3': BamHI
Site destroyed during cloning: No
5' Sequencing primer: tctcgagctcaagcttcgg  (List of Sequencing Primers)
3' Sequencing primer: tgtggtatggctgattatgatcag tt
Bacteria resistance: Kanamycin
High or low copy: Unknown
Grow in standard E. coli @ 37C: Yes
Selectable markers: Gentamicin
If you did not originally clone this gene, from whom and where did you receive the plasmid used to derive this plasmid: Michael Lerman, NCI-Frederick
Sequence:View sequence
Plasmid Provided In:DH5a
Principal Investigator:Lucy M. Anderson
Terms and Licenses:MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
CAG_enhancer 65 - 352
CMV_immearly_promoter 10 - 562
CMV_fwd_primer 519 - 539
CMV_promoter 520 - 589
EGFP_N_primer 679 - 658
EGFP 613 - 1329
ORF frame 1 613 - 1923
EGFP_C_primer 1266 - 1287
SV40_PA_terminator 1946 - 2174
EBV_rev_primer 2144 - 2163
f1_origin 2619 - 2313
AmpR_promoter 2698 - 2726
pBABE_3_primer 2812 - 2792
SV40_enhancer 3013 - 2798
SV40_promoter 2810 - 3078
SV40_origin 2977 - 3054
SV40pro_F_primer 3039 - 3058
ORF frame 2 3161 - 3955
NeoR/KanR 3164 - 3952
TK_PA_terminator 4130 - 4399
pBR322_origin 4547 - 5166
Unique restriction sites

AseI 7
NdeI 234
NheI 591
AgeI 600
BglII 1339
SacI 1350
HindIII 1352
NotI 1435
SacII 1441
BamHI 1924
XbaI 1936
BclI 1946
StuI 3110
ClaI 3129
NarI 3289
MscI 3371
FspI 3391
BstBI 3971
ApaLI 4893

Article: The von Hippel-Lindau tumor suppressor targets to mitochondria. Shiao YH et al. (Cancer Res. 2000 Jun 1. 60(11):2816-9. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 13390" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2010 Addgene, Inc. All Rights Reserved