|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Konrad Buessow > Scheich et al > pQLinkGD
Price: $65.00
 

 

This is commonly
requested with
pQLinkHD
pQLinkH
pQLinkN
pQLinkG2
Plasmid 13673: pQLinkGD
Gene/insert name: Gateway cassette
Alternative names: pDESTcoG
Insert size (bp): 2342
GenBank/Entrez ID of insert: EF025687
Fusion proteins or tags: GST
Terminal: N terminal on backbone
Vector backbone: pQE-2
(Search Vector Database)
Backbone manufacturer: Qiagen
Type of vector: Bacterial expression,Co-Expression
Backbone size (bp): 5356
Cloning site 5': attR1
Site destroyed during cloning: Yes
Cloning site 3': attR2
Site destroyed during cloning: Yes
5' Sequencing primer: pGEX5'  (List of Sequencing Primers)
3' Sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC
Bacteria resistance: Ampicillin, Chloramphenicol
High or low copy: Unknown
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: DB3.1 from Invitrogen
Sequence:View sequence
Plasmid Provided In:DB3.1
Principal Investigator:Konrad Buessow
Terms and Licenses:MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
GST 141 - 800
ORF frame 3 141 - 851
pGEX_5_primer 752 - 774
attR1 816 - 940
attR2 940 - 840
ccdB 1674 - 1369
CAT/CamR 2678 - 2019
attR2 2959 - 3059
attR1 3066 - 2959
ORF frame 2 3221 - 3952
CAT/CamR 3293 - 3952
rrnB_T1_terminator 4020 - 4063
lacI 5287 - 4196
pGEX_3_primer 5462 - 5440
pBR322_origin 6478 - 5859
Ampicillin 7493 - 6633
AmpR_promoter 7563 - 7535
Unique restriction sites

XhoI 1
BstBI 538
SmaI 1590
BamHI 2004
HindIII 3084
NheI 3254
NarI 4285
HpaI 4421
EcoRV 4477
ApaI 4720
AatII 7628

Article: Vectors for co-expression of an unrestricted number of proteins. Scheich C et al. (Nucleic Acids Res. 2007 Feb 20. ():. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 13673" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved