Addgene - pIS54 ADAR 3'UTR mut Plasmid Data

Browse > David Bartel > Lim et al > pIS54 ADAR 3'UTR mut

Price: $65.00

Plasmid Links

Related Plasmids

David Bartel Lab Plasmids

Other Links

NCBI: ADAR

ADAR antibodies

Print Friendly Email

Plasmid 14488: pIS54 ADAR 3'UTR mut

Gene/insert name:		ADAR 3'UTR mutant
Alternative names:		ADAR
Insert size (bp):		290
Gene/insert aliases:		ADAR, DSH, G1P1, IFI4, p136, ADAR1, DRADA, DSRAD, IFI-4, K88dsRBP
Species of gene(s):		H. sapiens (human)
Relevant mutations/deletions:		CATTCC’s were changed to AAGTAC's
Fusion proteins or tags:		luciferase
Terminal:		N terminal on backbone
Vector backbone:		pIS1 (Search Vector Database)
Backbone manufacturer:		Bartel Lab
Type of vector:		Mammalian expression,Luciferase
Backbone size (bp):		4085
Cloning site 5':		SacI
Site destroyed during cloning:		No
Cloning site 3':		XbaI
Site destroyed during cloning:		No
5' Sequencing primer:		n/a (List of Sequencing Primers)
3' Sequencing primer:		EBV rev primer (GTGGTTTGTCCAAACTCATC)
Bacteria resistance:		Ampicillin
High or low copy:		High Copy
Grow in standard E. coli @ 37C:		Yes
Sequence:		View sequence
Plasmid Provided In:		DH5a
Principal Investigator:		David Bartel
Terms and Licenses:		MTA, Luciferase LULL

Comments: ADAR 3'UTR mutant in renilla luciferase reporter plasmid.

This plasmid has not been sequence verified. If you would like Addgene to sequence a portion of this plasmid before you request it, please contact us.

Click on map to enlarge

Article: Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Lim LP et al. (Nature. 2005 Feb 17. 433(7027):769-73. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 14488" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.