|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Edward Boyden > Han et al > FCK-Halo-GFP
Price: $65.00
 

 

This is commonly
requested with
FCK-ChR2-GFP
pCAGGS-ChR2- Venus
Plasmid 14750: FCK-Halo-GFP
Gene/insert name: Mammalian codon-optimized halorhodopsin, from Natronomas pharaonis (N. pharaonis), fused with GFP at the C-terminus
Alternative names: Halo
Halo-GFP
NPhR
Insert size (bp): 1300
Species of gene(s): N. pharaonis
Relevant mutations/deletions: N. pharaonis halorhodopsin is mammalian codon-optimized
Fusion proteins or tags: GFP
Terminal: C terminal on insert
Vector backbone: FCK(1.3)GW
(Search Vector Database)
Backbone manufacturer: Pavel Osten
Type of vector: Mammalian expression,Lentiviral
Backbone size (bp): 9500
Cloning site 5': AgeI
Site destroyed during cloning: No
Cloning site 3': EcoRI
Site destroyed during cloning: No
5' Sequencing primer: atgactgagaccctcccacccgtg actgaaagcgccgt  (List of Sequencing Primers)
Bacteria resistance: Ampicillin
High or low copy: Unknown
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)
If you did not originally clone this gene, from whom and where did you receive the plasmid used to derive this plasmid: We purchased the gene to be synthesized by Epoch Biolabs (Sugar Land, TX)
Sequence:View sequence
Author's Map:View map
Plasmid Provided In:Stbl3
Principal Investigator:Edward Boyden
Terms and Licenses:MTA

Comments: PLEASE CONTACT ED BOYDEN (esb@media.mit.edu) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
CAG_enhancer 318 - 605
CMV_immearly_promoter 239 - 815
CMV_fwd_primer 772 - 792
HIV-1_5_LTR 835 - 1015
truncHIV-1_3_LTR 835 - 1015
HIV-1_psi_pack 1126 - 1170
RRE 1680 - 1913
ORF frame 1 1558 - 2445
cPPT 2444 - 2459
ORF frame 1 4425 - 3703
ORF frame 1 3745 - 5511
EGFP_N_primer 4858 - 4837
EGFP 4804 - 5508
EGFP_C_primer 5445 - 5466
WPRE 5538 - 6125
pBluescriptKS_primer 6144 - 6128
ORF frame 1 5626 - 6675
cPPT 6312 - 6327
U3PPT 6312 - 6333
HIV-1_5_LTR 6649 - 6829
truncHIV-1_3_LTR 6649 - 6829
BGH_rev_primer 6872 - 6855
bGH_PA_terminator 6858 - 7085
f1_origin 7148 - 7454
pBABE_3_primer 7588 - 7568
SV40_enhancer 7789 - 7574
SV40_promoter 7586 - 7854
SV40_origin 7753 - 7830
SV40pro_F_primer 7815 - 7834
EM7_promoter 7948 - 8015
bleo 8016 - 8387
sh_ble 8016 - 8390
SV40_PA_terminator 8523 - 8642
EBV_rev_primer 8611 - 8630
M13_reverse_primer 8704 - 8686
M13_pUC_rev_primer 8725 - 8703
lac_promoter 8768 - 8739
pBR322_origin 9696 - 9077
ORF frame 2 10711 - 9851
Ampicillin 10711 - 9851
AmpR_promoter 10781 - 10753
Unique restriction sites

SpeI 252
NdeI 487
NarI 1019
NotI 1525
XbaI 2651
BamHI 3895
AgeI 4782
EcoRI 5512
SacII 6039
XhoI 6140
KpnI 6262
FspI 10146

Article: Multiple-color optical activation, silencing, and desynchronization of neural activity, with single-spike temporal resolution. Han X et al. (PLoS ONE. 2007 . 2():e299. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 14750" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved