|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > David Spencer > Park et al > pSH1/Mf-del-Akt-E
Plasmid 15288: pSH1/Mf-del-Akt-E
Gene/insert name: delPH-Akt
Alternative names: PKB
Insert size (bp): 1240
Gene/insert aliases: Akt1, Akt, PKB, Rac, PKB/Akt, PKBalpha
Species of gene(s): M. musculus (mouse)
Relevant mutations/deletions: Truncated PH (residues 1-99)
Fusion proteins or tags: HA epitope
Terminal: C terminal on insert
Fusion proteins or tags: Myristoylation-targeting domain Fyn (16aa)
Terminal: N terminal on insert
Vector backbone: pSH1
(Search Vector Database)
Backbone manufacturer: GR Crabtree lab
Type of vector: Mammalian expression
Backbone size (bp): 3500
Cloning site 5': NotI, SacII
Site destroyed during cloning: No
Cloning site 3': EcoRI, BamHI
Site destroyed during cloning: No
5' Sequencing primer: gaggtgttacttctgctctaaaag c  (List of Sequencing Primers)
3' Sequencing primer: cactgcattctagttgtggtttg
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Sequence:View sequence
Author's Map:View map
Plasmid Provided In:DH5a
Principal Investigator:David Spencer
Terms and Licenses:MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
pBR322_origin 841 - 222
ORF frame 3 1856 - 996
Ampicillin 1856 - 996
AmpR_promoter 1926 - 1898
pBABE_3_primer 2129 - 2109
SV40_enhancer 2330 - 2115
SV40_promoter 2127 - 2395
SV40_origin 2294 - 2371
SV40pro_F_primer 2356 - 2375
SV40_late_19s_int 2774 - 2804
ORF frame 1 2944 - 4182
EBV_rev_primer 4247 - 4228
SV40_PA_terminator 4333 - 4214
pGEX_3_primer 4500 - 4478
Unique restriction sites

FspI 1291
AatII 1991
ClaI 2094
HindIII 2099
NotI 2930
SacII 2936
MscI 3115
PstI 3308
XhoI 3419
ApaI 3450
AgeI 3914
SalI 4141
EcoRI 4183

Article: An essential role for Akt1 in dendritic cell function and tumor immunotherapy. Park D et al. (Nat Biotechnol. 2006 Dec . 24(12):1581-90. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 15288" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved