|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Edward Boyden > Chow et al > FCK-Arch-GFP
Plasmid 22217: FCK-Arch-GFP
Gene/insert name: Arch
Alternative names: Arch-GFP
archaerhodopsin-3
H. sodomense archaerhodopsin-3
Insert size (bp): 1518
Species of gene(s): H. sodomense
Relevant mutations/deletions: NO
Fusion proteins or tags: GFP
Terminal: C terminal on insert
Vector backbone: FCK(1.3)GW
(Search Vector Database)
Backbone manufacturer: Pavel Osten
Type of vector: Mammalian expression,Lentiviral
Backbone size (bp): 9227
Cloning site 5': BamHI
Site destroyed during cloning: No
Cloning site 3': EcoRI
Site destroyed during cloning: No
5' Sequencing primer: atgactgagaccctcccacccgtg actgaaagcgccgt  (List of Sequencing Primers)
Bacteria resistance: Ampicillin
High or low copy: Unknown
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)
Sequence:View sequence
Author's Map:View map
Plasmid Provided In:Stbl3
Principal Investigator:Edward Boyden
Terms and Licenses:MTA

Comments: PLEASE CONTACT ED BOYDEN (esb@media.mit.edu) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
CAG_enhancer 318 - 605
CMV_immearly_promoter 239 - 815
CMV_fwd_primer 772 - 792
HIV-1_5_LTR 835 - 1015
truncHIV-1_3_LTR 835 - 1015
HIV-1_psi_pack 1126 - 1170
RRE 1680 - 1913
ORF frame 1 1558 - 2445
cPPT 2444 - 2459
ORF frame 1 3745 - 5412
EGFP_N_primer 4759 - 4738
EGFP 4705 - 5409
EGFP_C_primer 5346 - 5367
WPRE 5439 - 6026
pBluescriptKS_primer 6045 - 6029
ORF frame 1 5527 - 6576
cPPT 6213 - 6228
U3PPT 6213 - 6234
HIV-1_5_LTR 6550 - 6730
truncHIV-1_3_LTR 6550 - 6730
BGH_rev_primer 6773 - 6756
bGH_PA_terminator 6759 - 6986
f1_origin 7049 - 7355
pBABE_3_primer 7489 - 7469
SV40_enhancer 7690 - 7475
SV40_promoter 7487 - 7755
SV40_origin 7654 - 7731
SV40pro_F_primer 7716 - 7735
EM7_promoter 7849 - 7916
bleo 7917 - 8288
sh_ble 7917 - 8291
SV40_PA_terminator 8424 - 8543
EBV_rev_primer 8512 - 8531
M13_reverse_primer 8605 - 8587
M13_pUC_rev_primer 8626 - 8604
lac_promoter 8669 - 8640
pBR322_origin 9597 - 8978
ORF frame 2 10612 - 9752
Ampicillin 10612 - 9752
AmpR_promoter 10682 - 10654
Unique restriction sites

SpeI 252
NdeI 487
NarI 1019
NotI 1525
XbaI 2651
BamHI 3895
AgeI 4683
EcoRI 5413
XhoI 6041
KpnI 6163
MscI 7920
FspI 10047

Article: High-performance genetically targetable optical neural silencing by light-driven proton pumps. Chow BY et al. (Nature. 2010 Jan 7. 463(7277):98-102. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 22217" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved