|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Edward Boyden > Chow et al > FCK-Mac-GFP
Plasmid 22223: FCK-Mac-GFP
Gene/insert name: Mac
Alternative names: Mac-GFP
Leptosphaeria maculans opsin
opsin
Insert size (bp): 1683
Species of gene(s): L. maculans
Relevant mutations/deletions: NO
Fusion proteins or tags: GFP
Terminal: C terminal on insert
Vector backbone: FCK(1.3)GW
(Search Vector Database)
Backbone manufacturer: Pavel Osten
Type of vector: Mammalian expression,Lentiviral
Backbone size (bp): 9227
Cloning site 5': BamHI
Site destroyed during cloning: No
Cloning site 3': EcoRI
Site destroyed during cloning: No
5' Sequencing primer: atgactgagaccctcccacccgtg actgaaagcgccgt  (List of Sequencing Primers)
Bacteria resistance: Ampicillin
High or low copy: Unknown
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)
Sequence:View sequence
Author's Map:View map
Plasmid Provided In:Stbl3
Principal Investigator:Edward Boyden
Terms and Licenses:MTA

Comments: PLEASE CONTACT ED BOYDEN (esb@media.mit.edu) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
CAG_enhancer 318 - 605
CMV_immearly_promoter 239 - 815
CMV_fwd_primer 772 - 792
HIV-1_5_LTR 835 - 1015
truncHIV-1_3_LTR 835 - 1015
HIV-1_psi_pack 1126 - 1170
RRE 1680 - 1913
ORF frame 1 1558 - 2445
cPPT 2444 - 2459
ORF frame 1 3745 - 5577
EGFP_N_primer 4924 - 4903
EGFP 4870 - 5574
EGFP_C_primer 5511 - 5532
WPRE 5604 - 6191
pBluescriptKS_primer 6210 - 6194
ORF frame 1 5692 - 6741
cPPT 6378 - 6393
U3PPT 6378 - 6399
HIV-1_5_LTR 6715 - 6895
truncHIV-1_3_LTR 6715 - 6895
BGH_rev_primer 6938 - 6921
bGH_PA_terminator 6924 - 7151
f1_origin 7214 - 7520
pBABE_3_primer 7654 - 7634
SV40_enhancer 7855 - 7640
SV40_promoter 7652 - 7920
SV40_origin 7819 - 7896
SV40pro_F_primer 7881 - 7900
EM7_promoter 8014 - 8081
bleo 8082 - 8453
sh_ble 8082 - 8456
SV40_PA_terminator 8589 - 8708
EBV_rev_primer 8677 - 8696
M13_reverse_primer 8770 - 8752
M13_pUC_rev_primer 8791 - 8769
lac_promoter 8834 - 8805
pBR322_origin 9762 - 9143
ORF frame 2 10777 - 9917
Ampicillin 10777 - 9917
AmpR_promoter 10847 - 10819
Unique restriction sites

SpeI 252
NdeI 487
NotI 1525
XbaI 2651
BamHI 3895
AgeI 4848
EcoRI 5578
SacII 6105
XhoI 6206
KpnI 6328
FspI 10212

Article: High-performance genetically targetable optical neural silencing by light-driven proton pumps. Chow BY et al. (Nature. 2010 Jan 7. 463(7277):98-102. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 22223" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved