|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Edward Boyden > Chow et al > FCK-ss-Prl-Arch-GFP
Plasmid 22224: FCK-ss-Prl-Arch-GFP
Gene/insert name: ss-Prl-Arch-GFP
Alternative names: Arch
archaerhodopsin-3
H. sodomense archaerhodopsin-3
Insert size (bp): 1689
Species of gene(s): H. sodomense
Relevant mutations/deletions: no
Fusion proteins or tags: ss
Terminal: N terminal on insert
Fusion proteins or tags: Prl
Terminal: N terminal on insert
Fusion proteins or tags: GFP
Terminal: C terminal on insert
Vector backbone: FCK(1.3)GW
(Search Vector Database)
Backbone manufacturer: Pavel Osten
Type of vector: Mammalian expression,Lentiviral
Backbone size (bp): 9227
Cloning site 5': BamHI
Site destroyed during cloning: No
Cloning site 3': EcoRI
Site destroyed during cloning: No
5' Sequencing primer: atgactgagaccctcccacccgtg actgaaagcgccgt  (List of Sequencing Primers)
Bacteria resistance: Ampicillin
High or low copy: Unknown
Grow in standard E. coli @ 37C: No
Please specify bacterial strain for growth and growth condition: Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)
Sequence:View sequence
Author's Map:View map
Plasmid Provided In:Stbl3
Principal Investigator:Edward Boyden
Terms and Licenses:MTA

Comments: PLEASE CONTACT ED BOYDEN (esb@media.mit.edu) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
CAG_enhancer 318 - 605
CMV_immearly_promoter 239 - 815
CMV_fwd_primer 772 - 792
HIV-1_5_LTR 835 - 1015
truncHIV-1_3_LTR 835 - 1015
HIV-1_psi_pack 1126 - 1170
RRE 1680 - 1913
ORF frame 1 1558 - 2445
cPPT 2444 - 2459
ORF frame 1 3745 - 5580
EGFP_N_primer 4927 - 4906
EGFP 4873 - 5577
EGFP_C_primer 5514 - 5535
WPRE 5610 - 6197
pBluescriptKS_primer 6216 - 6200
ORF frame 1 5698 - 6747
cPPT 6384 - 6399
U3PPT 6384 - 6405
HIV-1_5_LTR 6721 - 6901
truncHIV-1_3_LTR 6721 - 6901
BGH_rev_primer 6944 - 6927
bGH_PA_terminator 6930 - 7157
f1_origin 7220 - 7526
pBABE_3_primer 7660 - 7640
SV40_enhancer 7861 - 7646
SV40_promoter 7658 - 7926
SV40_origin 7825 - 7902
SV40pro_F_primer 7887 - 7906
EM7_promoter 8020 - 8087
bleo 8088 - 8459
sh_ble 8088 - 8462
SV40_PA_terminator 8595 - 8714
EBV_rev_primer 8683 - 8702
M13_reverse_primer 8776 - 8758
M13_pUC_rev_primer 8797 - 8775
lac_promoter 8840 - 8811
pBR322_origin 9768 - 9149
ORF frame 2 10783 - 9923
Ampicillin 10783 - 9923
AmpR_promoter 10853 - 10825
Unique restriction sites

SpeI 252
NdeI 487
NarI 1019
NotI 1525
XbaI 2651
BamHI 3895
AgeI 4851
EcoRI 5584
XhoI 6212
KpnI 6334
MscI 8091
FspI 10218

Article: High-performance genetically targetable optical neural silencing by light-driven proton pumps. Chow BY et al. (Nature. 2010 Jan 7. 463(7277):98-102. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 22224" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved