|
Home
|
|
Deposit Plasmids
|
|
Request Plasmids
|
|
Plasmid Tools
|
|
About Addgene
|
 |
 |
 |
Browse > Jon Ashwell > Li et al > pgex-cIAP2 Price: $65.00 Plasmid Links Related Plasmids Other Links This is commonly requested with Plasmid 8335: pgex-cIAP2
| Gene/insert name: | | cIAP2 | |
| Insert size (bp): | | 1800 | |
| Gene/insert aliases: | | BIRC3, AIP1, API2, MIHC, CIAP2, HAIP1, HIAP1, MALT2, RNF49, c-IAP2 | |
| Species of gene(s): | | H. sapiens (human)
| |
| Fusion proteins or tags: | | GST | |
| Terminal: | | N terminal on backbone | |
| Vector backbone: | | pGEX (Search Vector Database) | |
| Backbone manufacturer: | | amersham | |
| Type of vector: | | Bacterial expression | |
| Backbone size (bp): | | 4900 | |
| Cloning site 5': | | BamH1 | |
| Site destroyed during cloning: | | No | |
| Cloning site 3': | | NotI | |
| Site destroyed during cloning: | | No | |
| 5' Sequencing primer: | | GGGCTGGCAAGCCACGTTTGGTGG (List of Sequencing Primers) | |
| 3' Sequencing primer: | | TCCGGGAGCTGCATGTGTCAGAGG | |
| Bacteria resistance: | | Ampicillin | |
| High or low copy: | | High Copy | |
| Grow in standard E. coli @ 37C: | | Yes | |
| Sequence: | | View sequence | | Plasmid Provided In: | | DH5a | | Principal Investigator: | | Jon Ashwell | | Terms and Licenses: | | MTA | Click on map to enlargeArticle: TNF-RII and c-IAP1 mediate ubiquitination and degradation of TRAF2. Li X et al. (Nature 2002 Mar 21;416(6878):345-7. Pubmed) Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 8335" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.
|
|