Addgene - pGEX-XIAP Plasmid Data

Gene/insert name:		XIAP
Insert size (bp):		1500
Gene/insert aliases:		XIAP, API3, ILP1, MIHA, XLP2, BIRC4
Species of gene(s):		H. sapiens (human)
Fusion proteins or tags:		GST
Terminal:		N terminal on backbone
Vector backbone:		pGEX (Search Vector Database)
Backbone manufacturer:		amersham
Type of vector:		Bacterial expression
Backbone size (bp):		4900
Cloning site 5':		BamH1
Site destroyed during cloning:		No
Cloning site 3':		NotI
Site destroyed during cloning:		No
5' Sequencing primer:		GGGCTGGCAAGCCACGTTTGGTGG (List of Sequencing Primers)
3' Sequencing primer:		TCCGGGAGCTGCATGTGTCAGAGG
Bacteria resistance:		Ampicillin
High or low copy:		High Copy
Grow in standard E. coli @ 37C:		Yes
Sequence:		View sequence
Plasmid Provided In:		DH5a
Principal Investigator:		Jon Ashwell
Terms and Licenses:		MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Article: Ubiquitin protein ligase activity of IAPs and their degradation in proteasomes in response to apoptotic stimuli. Yang Y et al. (Science 2000 May 5;288(5467):874-7. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 8340" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.