|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Jon Ashwell > Yang et al > pGEX-XIAP
Plasmid 8340: pGEX-XIAP
Gene/insert name: XIAP
Insert size (bp): 1500
Gene/insert aliases: XIAP, API3, ILP1, MIHA, XLP2, BIRC4
Species of gene(s): H. sapiens (human)
Fusion proteins or tags: GST
Terminal: N terminal on backbone
Vector backbone: pGEX
(Search Vector Database)
Backbone manufacturer: amersham
Type of vector: Bacterial expression
Backbone size (bp): 4900
Cloning site 5': BamH1
Site destroyed during cloning: No
Cloning site 3': NotI
Site destroyed during cloning: No
5' Sequencing primer: GGGCTGGCAAGCCACGTTTGGTGG  (List of Sequencing Primers)
3' Sequencing primer: TCCGGGAGCTGCATGTGTCAGAGG
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Sequence:View sequence
Plasmid Provided In:DH5a
Principal Investigator:Jon Ashwell
Terms and Licenses:MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Article: Ubiquitin protein ligase activity of IAPs and their degradation in proteasomes in response to apoptotic stimuli. Yang Y et al. (Science 2000 May 5;288(5467):874-7. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 8340" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved