| Gene/insert name: | | XIAP1-351 | |
| Alternative names: | | XIAP | |
| Insert size (bp): | | 1000 | |
| Gene/insert aliases: | | XIAP, API3, ILP1, MIHA, XLP2, BIRC4 | |
| Species of gene(s): | | H. sapiens (human)
| |
| Relevant mutations/deletions: | | deleted amino acids 352-496 | |
| Fusion proteins or tags: | | GST | |
| Terminal: | | N terminal on backbone | |
| Vector backbone: | | pGEX (Search Vector Database) | |
| Backbone manufacturer: | | amersham | |
| Type of vector: | | Bacterial expression | |
| Backbone size (bp): | | 4900 | |
| Cloning site 5': | | BamH1 | |
| Site destroyed during cloning: | | No | |
| Cloning site 3': | | NotI | |
| Site destroyed during cloning: | | No | |
| 5' Sequencing primer: | | GGGCTGGCAAGCCACGTTTGGTGG (List of Sequencing Primers) | |
| 3' Sequencing primer: | | TCCGGGAGCTGCATGTGTCAGAGG | |
| Bacteria resistance: | | Ampicillin | |
| High or low copy: | | High Copy | |
| Grow in standard E. coli @ 37C: | | Yes | |
| Sequence: | | View sequence |
| Plasmid Provided In: | | DH5a |
| Principal Investigator: | | Jon Ashwell |
| Terms and Licenses: | | MTA |