|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Kami Ahmad > Ahmad et al > HS-H3-GFP
Plasmid 8698: HS-H3-GFP
Gene/insert name: H3
Insert size (bp): 420
Gene/insert aliases: His3:CG31613, CG31613, Dmel\CG31613, His3
Species of gene(s): D. melanogaster (fly)
Fusion proteins or tags: GFP
Terminal: C terminal on backbone
Vector backbone: na
(Search Vector Database)
Type of vector: Insect expression
Backbone size (bp): 10200
Cloning site 5': XbaI
Site destroyed during cloning: No
Cloning site 3': EagI
Site destroyed during cloning: No
5' Sequencing primer: na  (List of Sequencing Primers)
3' Sequencing primer: CCATCTAATTCAACAAGAATTGGG ACAAC
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Sequence:View sequence
Plasmid Provided In:DH5a
Principal Investigator:Kami Ahmad
Terms and Licenses:MTA

Comments: Heat shock promoter. Ahmad lab #k90.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
pBR322_origin 840 - 233
ORF frame 2 1855 - 995
Ampicillin 1855 - 995
AmpR_promoter 1925 - 1897
pGEX_3_primer 2106 - 2084
5xGal4_DBD 3038 - 3131
HS_promoter 3150 - 3377
HS_promoter 3613 - 3840
GFP_R_primer 4376 - 4348
GFPfusionREV_primer 4411 - 4392
ORF frame 1 3892 - 5034
GFP(0-717) 4318 - 5034
GFP_F_primer 4971 - 4991
SV40_int 5123 - 5138
SV40_3_splice 5144 - 5191
SV40_PA_terminator 5767 - 5898
EBV_rev_primer 5855 - 5874
ORF frame 1 7255 - 7872
Unique restriction sites

FspI 1290
AatII 1990
EcoRI 3404
XhoI 3459
XbaI 3882
NheI 4177
EagI 4303
HpaI 5763
StuI 5913
SmaI 8072
EcoRV 8902

Article: The histone variant H3.3 marks active chromatin by replication-independent nucleosome assembly. Ahmad K et al. (Mol Cell 2002 Jun;9(6):1191-200. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 8698" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved
Plasmid Cart
Your cart is empty.

Recently Viewed
HS-H3-GFP
Plasmid 8698
Tyler Jacks
Lab Plasmids