|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Kami Ahmad > Ahmad et al > HS-H4-GFP
Plasmid 8699: HS-H4-GFP
Gene/insert name: H4
Insert size (bp): 320
Gene/insert aliases: His4:CG31611, CG31611, Dmel\CG31611
Species of gene(s): D. melanogaster (fly)
Fusion proteins or tags: GFP
Terminal: C terminal on backbone
Vector backbone: na
(Search Vector Database)
Type of vector: Insect expression
Backbone size (bp): 10200
Cloning site 5': XbaI
Site destroyed during cloning: No
Cloning site 3': EagI
Site destroyed during cloning: No
5' Sequencing primer: na  (List of Sequencing Primers)
3' Sequencing primer: CCATCTAATTCAACAAGAATTGGG ACAAC
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Sequence:View sequence
Plasmid Provided In:DH5a
Principal Investigator:Kami Ahmad
Terms and Licenses:MTA

Comments: Heat shock promoter. Ahmad lab #k163.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
pBR322_origin 840 - 233
ORF frame 2 1855 - 995
Ampicillin 1855 - 995
AmpR_promoter 1925 - 1897
pGEX_3_primer 2106 - 2084
5xGal4_DBD 3038 - 3131
HS_promoter 3150 - 3377
HS_promoter 3613 - 3840
GFP_R_primer 4273 - 4245
GFPfusionREV_primer 4308 - 4289
ORF frame 3 3876 - 4931
GFP(0-717) 4215 - 4931
GFP_F_primer 4868 - 4888
SV40_int 5020 - 5035
SV40_3_splice 5041 - 5088
SV40_PA_terminator 5664 - 5795
EBV_rev_primer 5752 - 5771
ORF frame 3 7152 - 7769
Unique restriction sites

FspI 1290
AatII 1990
EcoRI 3404
XhoI 3459
XbaI 3882
EagI 4200
HpaI 5660
StuI 5810
SmaI 7969
EcoRV 8799

Article: The histone variant H3.3 marks active chromatin by replication-independent nucleosome assembly. Ahmad K et al. (Mol Cell 2002 Jun;9(6):1191-200. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 8699" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved