Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAcUW51-gE2
(Plasmid #11621)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 11621 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAcUW51
  • Backbone manufacturer
    BD Biosciences
  • Backbone size w/o insert (bp) 5863
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HSV-1 glycoprotein E
  • Alt name
    HSV-1 gE
  • Species
    Herpes simplex virus type I KOS strain
  • Insert Size (bp)
    1233
  • Mutation
    deleted amino acids 391-550
  • Tag / Fusion Protein
    • His (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGGACCTTTAATTCAACCCAAC
  • 3′ sequencing primer TTGACACCAGACCAACTGGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAcUW51-gE2 was a gift from Pamela Bjorkman (Addgene plasmid # 11621 ; http://n2t.net/addgene:11621 ; RRID:Addgene_11621)
  • For your References section:

    pH dependence and stoichiometry of binding to the Fc region of IgG by the herpes simplex virus Fc receptor gE-gI. Sprague ER, Martin WL, Bjorkman PJ. J Biol Chem. 2004 Apr 2. 279(14):14184-93. 10.1074/jbc.M313281200 PubMed 14734541