Addgene - pAcUW51-gEgIL Plasmid Data

Browse > Pamela J. Bjorkman > Sprague et al > pAcUW51-gEgIL

Price: $65.00

Plasmid Links

Related Plasmids

Pamela Bjorkman Lab Plasmids

Print Friendly Email

Plasmid 11622: pAcUW51-gEgIL

Gene/insert name:		HSV-1 glycoprotein E and HSV-1 glycoprotein I
Alternative names:		HSV-1 gE
		HSV-1 gI
Insert size (bp):		1200
Species of gene(s):		herpes simplex virus type I KOS strain
Relevant mutations/deletions:		Dicistronic vector containing HSV-1 gE (KOS strain) ecotdomain (aa 21-419) between BglII and EcoRI site under the p10 promoter and HSV-1 gI (KOS strain) ectodomain (aa 21-265 with deletion of aa 221-227) in BamHI site under the ppolh promoter. gI contains a FactorXa-cleavable C-terminal His6 tag. gI insert sequenced with 5' primer CCGGATCTGATCATGGAGATAA 3' primer TCGCTCTAACATACCACCCT
Fusion proteins or tags:		His
Terminal:		C terminal on insert
Vector backbone:		pAcUW51 (Search Vector Database)
Backbone manufacturer:		BD Biosciences
Type of vector:		Insect expression
Backbone size (bp):		5863
Cloning site 5':		BglII
Site destroyed during cloning:		No
Cloning site 3':		EcoRI
Site destroyed during cloning:		No
5' Sequencing primer:		CGGACCTTTAATTCAACCCAAC (List of Sequencing Primers)
3' Sequencing primer:		TTGACACCAGACCAACTGGT
Bacteria resistance:		Ampicillin
High or low copy:		High Copy
Grow in standard E. coli @ 37C:		Yes
Sequence:		View sequence
Author's Map:		View map
Plasmid Provided In:		DH5a
Principal Investigator:		Pamela J. Bjorkman
Terms and Licenses:		MTA

This plasmid has not been sequence verified. If you would like Addgene to sequence a portion of this plasmid before you request it, please contact us.

Click on map to enlarge

Article: pH dependence and stoichiometry of binding to the Fc region of IgG by the herpes simplex virus Fc receptor gE-gI. Sprague ER et al. (J Biol Chem. 2004 Apr 2. 279(14):14184-93. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 11622" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.