|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Axel Nohturfft > Castoreno et al > pLDLR-Luc mutSRE
Plasmid 14945: pLDLR-Luc mutSRE
Gene/insert name: LDLR promoter mut SRE
Alternative names: LDL receptor promoter
LDL receptor
Insert size (bp): 340
GenBank/Entrez ID of insert: NC_000019
Gene/insert aliases: LDLR, FH, FHC, LDLCQ2
Species of gene(s): H. sapiens (human)
Relevant mutations/deletions: Point mutation in the SRE-1 sequence of the LDL receptor promoter (ATCACCCCAC changed to ATAACCCCAC)
Fusion proteins or tags: luciferase
Terminal: C terminal on backbone
Vector backbone: pGL2 basic
(Search Vector Database)
Backbone manufacturer: Promega
Type of vector: Mammalian expression,Luciferase
Backbone size (bp): 5597
Cloning site 5': SacI
Site destroyed during cloning: No
Cloning site 3': XhoI
Site destroyed during cloning: No
5' Sequencing primer: n/a  (List of Sequencing Primers)
3' Sequencing primer: LucNrev
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Sequence:View sequence
Author's Map:View map
Plasmid Provided In:DH5a
Principal Investigator:Axel Nohturfft
Terms and Licenses:MTA, Luciferase LULL

Comments: Primers used for site-directed mutagenesis: 5'- ggtgaagacatttgaaaataaccccactgcaa actcc -3' and 5'-GGAGTTTGCAGTGGGGTTATTTTCAAATGTCT TCACC -3'

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
LucNrev_primer 526 - 508
firefly_Luciferase 442 - 2073
ORF frame 1 442 - 2094
SV40_int 2334 - 2349
SV40_3_splice 2355 - 2402
SV40_PA_terminator 2978 - 3109
EBV_rev_primer 3066 - 3085
pBR322_origin 4026 - 3407
ORF frame 2 5041 - 4181
Ampicillin 5041 - 4181
AmpR_promoter 5111 - 5083
f1_origin 5190 - 5496
SV40_PA_terminator 5821 - 5940
EBV_rev_primer 5909 - 5928
Unique restriction sites

SmaI 3
KpnI 12
SacI 18
NheI 28
EagI 269
XhoI 399
BglII 403
HindIII 413
NarI 475
XbaI 489
EcoRI 1029
EcoRV 1780
ClaI 1807
BamHI 3105
SalI 3111

Article: Transcriptional regulation of phagocytosis-induced membrane biogenesis by sterol regulatory element binding proteins. Castoreno AB et al. (Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13129-34. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 14945" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved