|
Advanced Search
Home
Deposit Plasmids
Request Plasmids
Plasmid Tools
About Addgene
Browse > Axel Nohturfft > Castoreno et al > pHMGCS-Luc (aka: pES8)
Price: $65.00
 

 

This is commonly
requested with
pLDLR-Luc ( aka: pES7)
Plasmid 14947: pHMGCS-Luc (aka: pES8)
Gene/insert name: HMG CoA synthase promoter
Alternative names: 3-hydroxy-3-methylglutaryl CoA synthase
HMGCS
Insert size (bp): 400
GenBank/Entrez ID of insert: AH001829
Species of gene(s): hamster
Fusion proteins or tags: luciferase
Terminal: C terminal on backbone
Vector backbone: pGL2 basic
(Search Vector Database)
Backbone manufacturer: Promega
Type of vector: Mammalian expression,Luciferase
Backbone size (bp): 5597
Cloning site 3': HindIII
Site destroyed during cloning: No
5' Sequencing primer: n/a  (List of Sequencing Primers)
3' Sequencing primer: LucNrev
Bacteria resistance: Ampicillin
High or low copy: High Copy
Grow in standard E. coli @ 37C: Yes
Sequence:View sequence
Author's Map:View map
Plasmid Provided In:DH5a
Principal Investigator:Axel Nohturfft
Terms and Licenses:MTA, Luciferase LULL

Comments: To generate pHMGCS-Luc, a PCR fragment containing nucleotides –379 to –17 of the hamster 3-hydroxy-3-methylglutaryl (HMG) CoA synthase gene was cloned into pGL2-basic.

PCR'd using primers: CGATCTCCTCTCACTGACCTTC and GCAGCTTTATAGCCACCGACCC.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Click on map to enlarge

Selected features
LucNrev_primer 545 - 527
firefly_Luciferase 461 - 2092
ORF frame 2 461 - 2113
SV40_int 2353 - 2368
SV40_3_splice 2374 - 2421
SV40_PA_terminator 2997 - 3128
EBV_rev_primer 3085 - 3104
pBR322_origin 4045 - 3426
ORF frame 3 5060 - 4200
Ampicillin 5060 - 4200
AmpR_promoter 5130 - 5102
f1_origin 5209 - 5515
SV40_PA_terminator 5840 - 5959
EBV_rev_primer 5928 - 5947
Unique restriction sites

KpnI 397
NheI 413
XhoI 418
BglII 422
HindIII 432
NarI 494
XbaI 508
EcoRI 1048
EcoRV 1799
ClaI 1826
BamHI 3124
SalI 3130

Article: Transcriptional regulation of phagocytosis-induced membrane biogenesis by sterol regulatory element binding proteins. Castoreno AB et al. (Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13129-34. Pubmed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication.

Also, please include the text "Addgene plasmid 14947" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication.

Home | Contact | Terms of Use | MTA and Licenses | Privacy Policy | Site Map © 2003-2009 Addgene, Inc. All Rights Reserved