| Gene/insert name: | | Agrn | |
| Alternative names: | | Agrin | |
| Insert size (bp): | | 417 | |
| GenBank/Entrez ID of insert: | | NM_021604 | |
| Gene/insert aliases: | | Agrn, Agrin | |
| Species of gene(s): | | M. musculus (mouse)
| |
| Fusion proteins or tags: | | myc | |
| Terminal: | | C terminal on backbone | |
| Fusion proteins or tags: | | His | |
| Terminal: | | C terminal on backbone | |
| Vector backbone: | | pTrcHis2
(Search Vector Database) | |
| Backbone manufacturer: | | Invitrogen | |
| Type of vector: | | Bacterial expression | |
| Backbone size (bp): | | 4406 | |
| Cloning site 5': | | BamHI | |
| Site destroyed during cloning: | | No | |
| Cloning site 3': | | EcoRI | |
| Site destroyed during cloning: | | No | |
| 5' Sequencing primer: | | AGAGGTATATATTAATGTATCG (List of Sequencing Primers) | |
| 3' Sequencing primer: | | N/A | |
| Bacteria resistance: | | Ampicillin | |
| High or low copy: | | High Copy | |
| Grow in standard E. coli @ 37C: | | Yes | |
| Sequence: | | Visit www.addgene.org/11868 | | Principal Investigator: | | Martin Smith | Comments: Hilgenberg, L. G., Su, H., Gu, H., O'Dowd D, K. & Smith, M. A. (2006) alpha3Na+/K+-ATPase Is a neuronal receptor for agrin. Cell 125, 359-69. Article: The COOH-terminal domain of agrin signals via a synaptic receptor in central nervous system neurons. Hoover CL et al. (J Cell Biol. 2003 Jun 9. 161(5):923-32. Pubmed) Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11868" in your Materials and Methods section. This information allows Addgene to create a link from the plasmid page to your publication. |
