Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 40 of 49 results
  1. Working with Nuclear Receptors

    Type
    Blog Post
    ...evolved from chloramphenicol acetyltransferase to luciferase, the basic assay remains widely used today.  ...
  2. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly luciferase. The bait and prey...immunoprecipitated from the cells using the Protein A tag. The luciferase activities can then be measured and normalized... assess interactions. Higher relative firefly luciferase activity in the Co-IP compared of a control Co-IP...
  3. Bacterial Expression Systems

    Type
    Collection
    ...pTac GFP, Luciferase (LuxCDABE) Attila Karsi Broad host range vectors for expressing luciferase and fluorescent...Quorum sensing molecule) Cynthia Collins Contains luciferase inducible by the quorum sensing molecule, 3OC6HSL...promoter can be found in pCS-PesaRlux controlling luciferase expression. pCW-LIC 26098 3x Tac promoter (hybrid...
  4. Fluorescent Protein Guide

    Type
    Collection
    ... Resources You May Also Like... Luminescence: Luciferase Plasmids Blog: Which FP Should I Use? Blog: How...
  5. Plasmids 101: Control Plasmids

    Type
    Blog Post
    ...constitutively expresses a reporter protein (e.g., GFP or luciferase) that is either co-transfected with the test ...
  6. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer... primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...
  7. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer... primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...
  8. Plasmid Collections

    Type
    Collection
    ...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus...
  9. Tetracycline Inducible Expression

    Type
    Collection
    ...single copy in mammalian cells; Expresses firefly luciferase hairpin and GFP under pTREtight promoter None...pSBtet-GP Sleeping Beauty transposon system; has luciferase in cloning site; see article for additional selection...
Showing: 21 - 40 of 49 results