...apicomplexan organism Toxoplasma gondii to the infection of human fibroblasts. Toxoplasma mutants were generated...Mülleder M, et al. F1000Res. PubMed PMID: 27830062 Toxoplasma CRISPR knockout pooled library Parasites from... and livestock diseases such as malaria and toxoplasmosis. Despite their importance to global health, ...

... the brains of mice chronically infected with Toxoplasma gondii." The Journal of Immunology 182.10 (2009...cells and dendritic cells during infection with Toxoplasma gondii." PLoS Pathog 5.7 (2009): e1000505. PubMed...

...Parasites such as Plasmodium (malaria), Toxoplasma (toxoplasmosis), Trypanosoma (African sleeping sickness...PI Publication Libraries Toxoplasma CRISPR Knockout Pooled Library - Toxoplasma gondii CRISPR genome-wide...

...tagRFP Ebert pSAG1::CAS9-U6::sgUPRT 54467 Other/Toxoplasma gondii none, Q5 mutagenesis yes, cut S. pyogenes...pyogenes Sibley pU6-Universal 52694 Other/Toxoplasma gondii BsaI yes, cut S. pyogenes Lourido pRGE31 50929...

...2 plasmid) Knockout Human Moffat 3rd 4 70,948 Toxoplasma Knockout 80636 Knockout T. gondii Lourido N/A...

...Entamoeba histolytica Leishmania sp. Plasmodium sp. Toxoplasma gondii Trypanosoma sp. Plasmids for Viruses Species...

...ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes...