Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Showing: 21 - 27 of 27 results
  1. Validated gRNA Sequences

    Type
    Collection
    ...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...
  2. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...2015 Jan 22. sgRNA1_GAL4UAS-Luciferase reporter sgRNA1 for GAL4UAS-Luciferase reporter (Synthetic) Mammalian...2015 Jan 22. sgRNA2_GAL4UAS-Luciferase reporter sgRNA2 for GAL4UAS-Luciferase reporter (Synthetic) Mammalian...2015 Jan 22. sgRNA3_GAL4UAS-Luciferase reporter sgRNA3 for GAL4UAS-Luciferase reporter (Synthetic) Mammalian...2015 Jan 22. sgRNA1_pNeurog2-Luciferase reporter sgRNA1 for pNeurog2-Luciferase reporter (Synthetic) Mammalian.... sgRNA1_Tet-inducible Luciferase reporter sgRNA1 for Tet-inducible Luciferase reporter (Synthetic) Mammalian...pAAV-Ai14-luc U6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA (Synthetic) AAV, CRISPR, Luciferase Belmonte In vivo genome.... doi: 10.7554/eLife.44161. pXPR_BRD003 Luciferase Luciferase (Other) CRISPR Hahn Renal medullary carcinomas...
  3. Worm Expression Resources

    Type
    Collection
    ...Min Han). Backbone pPD95.79 (Firelab). firefly luciferase luc+ fused to GFP (S65C) (Other) Glover 51868...Caenorhabditis elegans) Wolberger 37328 pCLucf Luciferase (Drosophila melanogaster), GFP Schiller 37487...
  4. Synthetic Biology - Cloning and Genomic Tools

    Type
    Collection
    ...LuxCDABE, VioABCE, LacZ Bacterial Expression, Luciferase, Synthetic Biology ; Phagemid Anderson Scalable...GB0160) Module for the expression of the Renilla Luciferase with the silencing suppressor P19 Renilla / P19... P19 (Other) Plant Expression, Luciferase, Synthetic Biology Orzaez A modular toolbox for gRNA-Cas9 genome...
  5. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-1-PV1917 105541-AAV1...James M. Wilson AV-8-PV0105 105532-AAV8 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-8-PV0146 105535-AAV8...Karl Deisseroth AV-5-PV0105 105532-AAV5 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-5-PV1090 105537-AAV5... M. Wilson AV-8-PV1302 105538-AAV8 pENN.AAV.TBG.PI.ffLuciferase.RBG James M. Wilson AV-8-PV3637 65015-...Karl Deisseroth AV-9-PV0105 105532-AAV9 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-9-PV0109 105533-AAV9...Karl Deisseroth AV-2-PV0105 105532-AAV2 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-1-PV3365 105554-AAV1...
  6. Control AAV Preps

    Type
    Collection
    ...Constitutive 1, 5, 8, 9 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 1, 8 Wilson 105536...
  7. Synthetic Biology - Networks and Gene Regulation

    Type
    Collection
    ...2015 Nov 30. pii: gkv1289. AEB-No-aptamer-controlluciferase No-aptamer control mRNA (Synthetic) Synthetic... 30. pii: gkv1289. Mishler2014-No-aptamer-controlluciferase-pUC19 No-aptamer control mRNA (Synthetic) ...
Showing: 21 - 27 of 27 results