Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Showing: 1 - 7 of 7 results
  1. Adenovirus Guide

    Type
    Guide
    ...pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest...vectors that contain IRES-GFP pShuttle Class of transfer vectors that do not contain GFP Additional Vocabulary...throughout virus production. During experiments, GFP can be used to sort cells infected with adenovirus...
  2. Sequencing Primers

    Type
    Guide
    ...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...
  3. Chemogenetics Guide

    Type
    Guide
    ...9 1.2 ± 0.4 1 Mean of GFP spread using CMV, CaMKII, and SynI promoter-driven GFP expression *significantly...Serotype-dependent spreading profiles of AAV-mediated GFP expression in the marmoset cerebral cortex (Adapted...
  4. Lentiviral Guide

    Type
    Guide
    ...another marker, such as GFP. A researcher can use FACS to sort cells expressing GFP and later expand these...
  5. CRISPR Guide

    Type
    Guide
    ...inactive dCas9 fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive...
  6. Optogenetics Guide

    Type
    Guide
    ...plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ, ePDZb and ePDZb1 as tags. pDawn/pDusk...
  7. Molecular Biology Reference

    Type
    Guide
    ...contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic...
Showing: 1 - 7 of 7 results