Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Showing: 1 - 2 of 2 results
  1. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer... primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...
  2. Molecular Biology Reference

    Type
    Guide
    ...plasmids contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...
Showing: 1 - 2 of 2 results